Incidental Mutation 'R0011:Pik3r4'
ID98984
Institutional Source Beutler Lab
Gene Symbol Pik3r4
Ensembl Gene ENSMUSG00000032571
Gene Namephosphoinositide-3-kinase regulatory subunit 4
SynonymsD9Ertd418e, 2210010O15Rik, C730038E05Rik
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0011 (G1)
Quality Score80
Status Validated
Chromosome9
Chromosomal Location105642978-105687657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105644637 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 134 (T134K)
Ref Sequence ENSEMBL: ENSMUSP00000139427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000188784] [ENSMUST00000190358] [ENSMUST00000191268]
Predicted Effect probably benign
Transcript: ENSMUST00000065778
AA Change: T134K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: T134K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187573
Predicted Effect probably benign
Transcript: ENSMUST00000188784
AA Change: T134K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140988
Gene: ENSMUSG00000032571
AA Change: T134K

DomainStartEndE-ValueType
S_TKc 26 301 2.8e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190358
AA Change: T134K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139643
Gene: ENSMUSG00000032571
AA Change: T134K

DomainStartEndE-ValueType
S_TKc 26 174 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191117
Predicted Effect probably benign
Transcript: ENSMUST00000191268
AA Change: T134K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: T134K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Pik3r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pik3r4 APN 9 105644604 missense possibly damaging 0.75
IGL01617:Pik3r4 APN 9 105654965 missense probably benign 0.33
IGL01764:Pik3r4 APN 9 105685122 splice site probably benign
IGL01817:Pik3r4 APN 9 105650822 missense probably damaging 1.00
IGL01830:Pik3r4 APN 9 105644955 missense probably damaging 1.00
IGL01905:Pik3r4 APN 9 105644878 nonsense probably null
IGL01947:Pik3r4 APN 9 105686150 missense possibly damaging 0.91
IGL01985:Pik3r4 APN 9 105663045 missense probably benign 0.03
IGL02321:Pik3r4 APN 9 105644478 missense probably benign 0.04
IGL02389:Pik3r4 APN 9 105650331 missense possibly damaging 0.88
IGL02898:Pik3r4 APN 9 105650406 missense probably benign 0.21
IGL03037:Pik3r4 APN 9 105650813 missense probably damaging 1.00
boteh UTSW 9 105667938 splice site probably null
IGL02835:Pik3r4 UTSW 9 105672706 missense probably benign 0.07
R0312:Pik3r4 UTSW 9 105686210 missense probably damaging 1.00
R0321:Pik3r4 UTSW 9 105648707 missense probably damaging 1.00
R0482:Pik3r4 UTSW 9 105669045 missense probably benign 0.04
R0645:Pik3r4 UTSW 9 105669187 splice site probably benign
R0690:Pik3r4 UTSW 9 105653976 missense possibly damaging 0.81
R0789:Pik3r4 UTSW 9 105685167 missense probably benign 0.14
R0894:Pik3r4 UTSW 9 105667771 missense possibly damaging 0.73
R0988:Pik3r4 UTSW 9 105687205 missense probably damaging 0.97
R1123:Pik3r4 UTSW 9 105663129 missense probably benign
R1172:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1174:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1342:Pik3r4 UTSW 9 105650901 critical splice donor site probably null
R1387:Pik3r4 UTSW 9 105644291 missense probably damaging 1.00
R1480:Pik3r4 UTSW 9 105687244 missense probably benign 0.39
R1638:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R1643:Pik3r4 UTSW 9 105687152 missense possibly damaging 0.83
R1995:Pik3r4 UTSW 9 105669165 missense probably benign 0.12
R2037:Pik3r4 UTSW 9 105650335 missense probably benign 0.00
R2165:Pik3r4 UTSW 9 105672785 missense probably benign 0.05
R4210:Pik3r4 UTSW 9 105650758 missense possibly damaging 0.57
R4515:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4519:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4630:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4632:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4732:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4733:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4940:Pik3r4 UTSW 9 105668994 missense probably benign 0.20
R5120:Pik3r4 UTSW 9 105669009 missense probably benign 0.30
R5169:Pik3r4 UTSW 9 105678161 missense probably benign 0.14
R5183:Pik3r4 UTSW 9 105682308 missense possibly damaging 0.87
R5353:Pik3r4 UTSW 9 105667938 splice site probably null
R5463:Pik3r4 UTSW 9 105648731 missense probably damaging 1.00
R5635:Pik3r4 UTSW 9 105667825 missense probably benign 0.01
R5763:Pik3r4 UTSW 9 105669775 missense probably benign 0.01
R5830:Pik3r4 UTSW 9 105644824 nonsense probably null
R6251:Pik3r4 UTSW 9 105654048 missense probably benign
R6468:Pik3r4 UTSW 9 105685190 missense possibly damaging 0.86
R6611:Pik3r4 UTSW 9 105644277 missense probably damaging 0.99
R6642:Pik3r4 UTSW 9 105644646 missense probably benign 0.11
R6821:Pik3r4 UTSW 9 105650606 missense probably damaging 0.98
R7039:Pik3r4 UTSW 9 105676890 missense possibly damaging 0.76
R7144:Pik3r4 UTSW 9 105650584 missense probably damaging 0.98
R7410:Pik3r4 UTSW 9 105650591 missense probably damaging 0.99
R7559:Pik3r4 UTSW 9 105678153 missense probably benign 0.17
R7561:Pik3r4 UTSW 9 105687247 missense possibly damaging 0.94
R7658:Pik3r4 UTSW 9 105644511 missense probably damaging 0.98
R7727:Pik3r4 UTSW 9 105669882 missense probably damaging 0.99
R7871:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
R7954:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAATCAGGCTCCACTCCGC -3'
(R):5'- GCTGATCTGACTGACTCACACACC -3'

Sequencing Primer
(F):5'- ACTCCGCCCAGAACTGC -3'
(R):5'- TACTCTAACTCGGTGGCGAAC -3'
Posted On2014-01-10