Mutagenetix > Incidental Mutations

Incidental Mutation 'R0011:Pik3r4'

98984

Institutional Source

Beutler Lab

Gene Symbol

Pik3r4

Ensembl Gene

ENSMUSG00000032571

Gene Name

phosphoinositide-3-kinase regulatory subunit 4

Synonyms

D9Ertd418e, 2210010O15Rik, C730038E05Rik

MMRRC Submission

038306-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0011 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

105642978-105687657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 105644637 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 134 (T134K)

Ref Sequence

ENSEMBL: ENSMUSP00000139427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000188784] [ENSMUST00000190358] [ENSMUST00000191268]

Predicted Effect

probably benign
Transcript: ENSMUST00000065778
AA Change: T134K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: T134K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	1.7e-5	PFAM
Pfam:Pkinase	26	312	1.2e-18	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187573

Predicted Effect

probably benign
Transcript: ENSMUST00000188784
AA Change: T134K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000140988
Gene: ENSMUSG00000032571
AA Change: T134K

Domain	Start	End	E-Value	Type
S_TKc	26	301	2.8e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190358
AA Change: T134K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139643
Gene: ENSMUSG00000032571
AA Change: T134K

Domain	Start	End	E-Value	Type
S_TKc	26	174	2e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191117

Predicted Effect

probably benign
Transcript: ENSMUST00000191268
AA Change: T134K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: T134K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	8.9e-7	PFAM
Pfam:Pkinase	26	312	3.7e-23	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Meta Mutation Damage Score

0.1168

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 95.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	T	A	7: 131,229,993	L389Q	probably damaging	Het
A930011G23Rik	T	C	5: 99,232,354	Y344C	probably damaging	Het
Alox15	A	G	11: 70,349,596	V253A	possibly damaging	Het
Ank3	A	G	10: 69,979,451		probably benign	Het
Art3	T	A	5: 92,403,612	Y17N	probably damaging	Het
Asic3	C	T	5: 24,417,492		probably benign	Het
Bach2	G	T	4: 32,244,655		probably benign	Het
Brip1	C	A	11: 86,186,998	K201N	possibly damaging	Het
Casc1	T	A	6: 145,179,055	M515L	probably damaging	Het
Ccdc88a	T	C	11: 29,374,364	F6S	probably damaging	Het
Celsr2	A	G	3: 108,413,402	I698T	probably benign	Het
Cenpf	A	G	1: 189,650,706	S2664P	probably benign	Het
Cfap54	A	T	10: 93,065,225	C156S	probably damaging	Het
Cops4	C	A	5: 100,527,981	Q28K	probably benign	Het
Cyb5a	T	A	18: 84,877,822		probably benign	Het
Diaph3	A	T	14: 86,866,408	C847S	probably damaging	Het
Dnah3	T	C	7: 120,019,701	K1648R	probably damaging	Het
Emilin2	C	T	17: 71,273,868	G621E	probably benign	Het
Enpp1	T	A	10: 24,670,002	K228*	probably null	Het
Epg5	T	C	18: 77,948,483	C132R	probably benign	Het
Epha7	G	A	4: 28,962,564	D961N	probably benign	Het
G6pc2	C	A	2: 69,226,565		probably benign	Het
Gm7361	C	T	5: 26,258,878		probably benign	Het
Grin2c	T	C	11: 115,255,750	Y476C	probably damaging	Het
Hnrnpul1	T	G	7: 25,742,915		probably benign	Het
Igf2bp1	T	C	11: 96,005,584	D17G	probably damaging	Het
Insrr	T	C	3: 87,809,616	C688R	possibly damaging	Het
Itgb2l	T	C	16: 96,427,661		probably benign	Het
Kidins220	T	A	12: 24,999,352	V322E	probably damaging	Het
Klk1	C	T	7: 44,229,535	T149I	probably benign	Het
Mbd3l1	A	G	9: 18,484,567		probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mrc1	T	C	2: 14,261,337		probably null	Het
Mtr	T	C	13: 12,238,052		probably benign	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Npy4r	C	T	14: 34,146,723	V203M	probably damaging	Het
Olfr965	T	A	9: 39,719,627	N133K	probably benign	Het
Rdh19	T	A	10: 127,856,911	L149Q	probably damaging	Het
Sema3e	C	T	5: 14,144,011	R85*	probably null	Het
Shtn1	A	G	19: 59,032,218	S191P	possibly damaging	Het
Slc39a11	A	T	11: 113,247,833	F279L	probably benign	Het
Slc4a1	T	C	11: 102,357,110	K353E	possibly damaging	Het
Slc6a18	A	T	13: 73,665,619	M515K	possibly damaging	Het
Snapc4	A	G	2: 26,364,813	I1225T	probably benign	Het
Spidr	A	T	16: 15,966,603	W534R	probably benign	Het
Tmem202	T	A	9: 59,524,801	N81I	probably benign	Het
Tnfrsf1b	T	G	4: 145,222,966	R297S	possibly damaging	Het
Trim55	A	G	3: 19,670,999	T227A	probably benign	Het
Trim58	A	T	11: 58,643,120	T167S	probably benign	Het
Trp53i11	A	T	2: 93,199,353		probably benign	Het
Ttn	T	C	2: 76,810,355	H5356R	probably damaging	Het
Tyrp1	C	T	4: 80,840,793	T301I	probably damaging	Het
Wdr17	A	T	8: 54,672,501	I448K	possibly damaging	Het
Wscd1	T	C	11: 71,788,828	V509A	probably damaging	Het
Zfp251	A	G	15: 76,854,554	V108A	probably benign	Het

Other mutations in Pik3r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Pik3r4	APN	9	105644604	missense	possibly damaging	0.75
IGL01617:Pik3r4	APN	9	105654965	missense	probably benign	0.33
IGL01764:Pik3r4	APN	9	105685122	splice site	probably benign
IGL01817:Pik3r4	APN	9	105650822	missense	probably damaging	1.00
IGL01830:Pik3r4	APN	9	105644955	missense	probably damaging	1.00
IGL01905:Pik3r4	APN	9	105644878	nonsense	probably null
IGL01947:Pik3r4	APN	9	105686150	missense	possibly damaging	0.91
IGL01985:Pik3r4	APN	9	105663045	missense	probably benign	0.03
IGL02321:Pik3r4	APN	9	105644478	missense	probably benign	0.04
IGL02389:Pik3r4	APN	9	105650331	missense	possibly damaging	0.88
IGL02898:Pik3r4	APN	9	105650406	missense	probably benign	0.21
IGL03037:Pik3r4	APN	9	105650813	missense	probably damaging	1.00
boteh	UTSW	9	105667938	splice site	probably null
IGL02835:Pik3r4	UTSW	9	105672706	missense	probably benign	0.07
R0312:Pik3r4	UTSW	9	105686210	missense	probably damaging	1.00
R0321:Pik3r4	UTSW	9	105648707	missense	probably damaging	1.00
R0482:Pik3r4	UTSW	9	105669045	missense	probably benign	0.04
R0645:Pik3r4	UTSW	9	105669187	splice site	probably benign
R0690:Pik3r4	UTSW	9	105653976	missense	possibly damaging	0.81
R0789:Pik3r4	UTSW	9	105685167	missense	probably benign	0.14
R0894:Pik3r4	UTSW	9	105667771	missense	possibly damaging	0.73
R0988:Pik3r4	UTSW	9	105687205	missense	probably damaging	0.97
R1123:Pik3r4	UTSW	9	105663129	missense	probably benign
R1172:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1174:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1342:Pik3r4	UTSW	9	105650901	critical splice donor site	probably null
R1387:Pik3r4	UTSW	9	105644291	missense	probably damaging	1.00
R1480:Pik3r4	UTSW	9	105687244	missense	probably benign	0.39
R1638:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R1643:Pik3r4	UTSW	9	105687152	missense	possibly damaging	0.83
R1995:Pik3r4	UTSW	9	105669165	missense	probably benign	0.12
R2037:Pik3r4	UTSW	9	105650335	missense	probably benign	0.00
R2165:Pik3r4	UTSW	9	105672785	missense	probably benign	0.05
R4210:Pik3r4	UTSW	9	105650758	missense	possibly damaging	0.57
R4515:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4519:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4630:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4632:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4732:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4733:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4940:Pik3r4	UTSW	9	105668994	missense	probably benign	0.20
R5120:Pik3r4	UTSW	9	105669009	missense	probably benign	0.30
R5169:Pik3r4	UTSW	9	105678161	missense	probably benign	0.14
R5183:Pik3r4	UTSW	9	105682308	missense	possibly damaging	0.87
R5353:Pik3r4	UTSW	9	105667938	splice site	probably null
R5463:Pik3r4	UTSW	9	105648731	missense	probably damaging	1.00
R5635:Pik3r4	UTSW	9	105667825	missense	probably benign	0.01
R5763:Pik3r4	UTSW	9	105669775	missense	probably benign	0.01
R5830:Pik3r4	UTSW	9	105644824	nonsense	probably null
R6251:Pik3r4	UTSW	9	105654048	missense	probably benign
R6468:Pik3r4	UTSW	9	105685190	missense	possibly damaging	0.86
R6611:Pik3r4	UTSW	9	105644277	missense	probably damaging	0.99
R6642:Pik3r4	UTSW	9	105644646	missense	probably benign	0.11
R6821:Pik3r4	UTSW	9	105650606	missense	probably damaging	0.98
R7039:Pik3r4	UTSW	9	105676890	missense	possibly damaging	0.76
R7144:Pik3r4	UTSW	9	105650584	missense	probably damaging	0.98
R7410:Pik3r4	UTSW	9	105650591	missense	probably damaging	0.99
R7559:Pik3r4	UTSW	9	105678153	missense	probably benign	0.17
R7561:Pik3r4	UTSW	9	105687247	missense	possibly damaging	0.94
R7658:Pik3r4	UTSW	9	105644511	missense	probably damaging	0.98
R7727:Pik3r4	UTSW	9	105669882	missense	probably damaging	0.99
R7871:Pik3r4	UTSW	9	105663117	missense	probably damaging	1.00
R7957:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R8138:Pik3r4	UTSW	9	105669035	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- TGAAAATCAGGCTCCACTCCGC -3'
(R):5'- GCTGATCTGACTGACTCACACACC -3'

Sequencing Primer
(F):5'- ACTCCGCCCAGAACTGC -3'
(R):5'- TACTCTAACTCGGTGGCGAAC -3'

Posted On

2014-01-10