Incidental Mutation 'R0011:Slc4a1'
ID 98987
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
MMRRC Submission 038306-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0011 (G1)
Quality Score 77
Status Validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102247936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 353 (K353E)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect possibly damaging
Transcript: ENSMUST00000006749
AA Change: K353E

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: K353E

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151050
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,380,213 (GRCm39) Y344C probably damaging Het
Alox15 A G 11: 70,240,422 (GRCm39) V253A possibly damaging Het
Ank3 A G 10: 69,815,281 (GRCm39) probably benign Het
Art3 T A 5: 92,551,471 (GRCm39) Y17N probably damaging Het
Asic3 C T 5: 24,622,490 (GRCm39) probably benign Het
Bach2 G T 4: 32,244,655 (GRCm39) probably benign Het
Brip1 C A 11: 86,077,824 (GRCm39) K201N possibly damaging Het
Ccdc88a T C 11: 29,324,364 (GRCm39) F6S probably damaging Het
Cdcp3 T A 7: 130,831,722 (GRCm39) L389Q probably damaging Het
Celsr2 A G 3: 108,320,718 (GRCm39) I698T probably benign Het
Cenpf A G 1: 189,382,903 (GRCm39) S2664P probably benign Het
Cfap54 A T 10: 92,901,087 (GRCm39) C156S probably damaging Het
Cops4 C A 5: 100,675,847 (GRCm39) Q28K probably benign Het
Cyb5a T A 18: 84,895,947 (GRCm39) probably benign Het
Diaph3 A T 14: 87,103,844 (GRCm39) C847S probably damaging Het
Dnah3 T C 7: 119,618,924 (GRCm39) K1648R probably damaging Het
Dnai7 T A 6: 145,124,781 (GRCm39) M515L probably damaging Het
Emilin2 C T 17: 71,580,863 (GRCm39) G621E probably benign Het
Enpp1 T A 10: 24,545,900 (GRCm39) K228* probably null Het
Epg5 T C 18: 77,991,698 (GRCm39) C132R probably benign Het
Epha7 G A 4: 28,962,564 (GRCm39) D961N probably benign Het
G6pc2 C A 2: 69,056,909 (GRCm39) probably benign Het
Gm7361 C T 5: 26,463,876 (GRCm39) probably benign Het
Grin2c T C 11: 115,146,576 (GRCm39) Y476C probably damaging Het
Hnrnpul1 T G 7: 25,442,340 (GRCm39) probably benign Het
Igf2bp1 T C 11: 95,896,410 (GRCm39) D17G probably damaging Het
Insrr T C 3: 87,716,923 (GRCm39) C688R possibly damaging Het
Itgb2l T C 16: 96,228,861 (GRCm39) probably benign Het
Kidins220 T A 12: 25,049,351 (GRCm39) V322E probably damaging Het
Klk1 C T 7: 43,878,959 (GRCm39) T149I probably benign Het
Mbd3l1 A G 9: 18,395,863 (GRCm39) probably benign Het
Miox C T 15: 89,220,477 (GRCm39) L189F possibly damaging Het
Mrc1 T C 2: 14,266,148 (GRCm39) probably null Het
Mtr T C 13: 12,252,938 (GRCm39) probably benign Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Npy4r C T 14: 33,868,680 (GRCm39) V203M probably damaging Het
Or8g52 T A 9: 39,630,923 (GRCm39) N133K probably benign Het
Pik3r4 C A 9: 105,521,836 (GRCm39) T134K probably benign Het
Rdh19 T A 10: 127,692,780 (GRCm39) L149Q probably damaging Het
Sema3e C T 5: 14,194,025 (GRCm39) R85* probably null Het
Shtn1 A G 19: 59,020,650 (GRCm39) S191P possibly damaging Het
Slc39a11 A T 11: 113,138,659 (GRCm39) F279L probably benign Het
Slc6a18 A T 13: 73,813,738 (GRCm39) M515K possibly damaging Het
Snapc4 A G 2: 26,254,825 (GRCm39) I1225T probably benign Het
Spidr A T 16: 15,784,467 (GRCm39) W534R probably benign Het
Tmem202 T A 9: 59,432,084 (GRCm39) N81I probably benign Het
Tnfrsf1b T G 4: 144,949,536 (GRCm39) R297S possibly damaging Het
Trim55 A G 3: 19,725,163 (GRCm39) T227A probably benign Het
Trim58 A T 11: 58,533,946 (GRCm39) T167S probably benign Het
Trp53i11 A T 2: 93,029,698 (GRCm39) probably benign Het
Ttn T C 2: 76,640,699 (GRCm39) H5356R probably damaging Het
Tyrp1 C T 4: 80,759,030 (GRCm39) T301I probably damaging Het
Wdr17 A T 8: 55,125,536 (GRCm39) I448K possibly damaging Het
Wscd1 T C 11: 71,679,654 (GRCm39) V509A probably damaging Het
Zfp251 A G 15: 76,738,754 (GRCm39) V108A probably benign Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R0635:Slc4a1 UTSW 11 102,243,498 (GRCm39) missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102,247,656 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102,252,209 (GRCm39) missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102,241,140 (GRCm39) missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102,252,048 (GRCm39) nonsense probably null
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102,244,693 (GRCm39) missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATAATTGTCACTGACCCAGGAGGC -3'
(R):5'- TGTAGGTGTTCCGCATTACCGC -3'

Sequencing Primer
(F):5'- GCCGGATATCACGGATCAG -3'
(R):5'- TCTCTGGAGAGCTTTCTGGA -3'
Posted On 2014-01-10