Incidental Mutation 'R0011:Miox'
ID98994
Institutional Source Beutler Lab
Gene Symbol Miox
Ensembl Gene ENSMUSG00000022613
Gene Namemyo-inositol oxygenase
SynonymsC85427, 0610009I10Rik, RSOR, Aldrl6
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R0011 (G1)
Quality Score36
Status Validated
Chromosome15
Chromosomal Location89334398-89337015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89336274 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 189 (L189F)
Ref Sequence ENSEMBL: ENSMUSP00000023282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023282] [ENSMUST00000162756]
PDB Structure
Crystal structure of mouse myo-inositol oxygenase in complex with substrate [X-RAY DIFFRACTION]
Crystal structure of Mouse Myo-inositol oxygenase (re-refined) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023282
AA Change: L189F

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023282
Gene: ENSMUSG00000022613
AA Change: L189F

DomainStartEndE-ValueType
Pfam:MIOX 31 285 2.1e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161437
Predicted Effect probably benign
Transcript: ENSMUST00000162033
SMART Domains Protein: ENSMUSP00000123732
Gene: ENSMUSG00000022613

DomainStartEndE-ValueType
Pfam:MIOX 1 53 7.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162756
SMART Domains Protein: ENSMUSP00000125302
Gene: ENSMUSG00000022613

DomainStartEndE-ValueType
Pfam:DUF706 40 128 8.7e-30 PFAM
Meta Mutation Damage Score 0.5379 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Miox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:Miox APN 15 89336084 missense possibly damaging 0.48
R0001:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0011:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0039:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0043:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0079:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0081:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0109:Miox UTSW 15 89335581 missense probably benign 0.17
R0109:Miox UTSW 15 89335581 missense probably benign 0.17
R0134:Miox UTSW 15 89334454 unclassified probably benign
R0166:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0172:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0173:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0225:Miox UTSW 15 89334454 unclassified probably benign
R0284:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0285:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0288:Miox UTSW 15 89336274 missense possibly damaging 0.48
R0681:Miox UTSW 15 89336274 missense possibly damaging 0.48
R1383:Miox UTSW 15 89335042 missense probably damaging 1.00
R4620:Miox UTSW 15 89336121 missense probably benign 0.43
R5016:Miox UTSW 15 89335564 missense probably null 1.00
R5110:Miox UTSW 15 89335556 missense probably benign
R5393:Miox UTSW 15 89336247 nonsense probably null
R6136:Miox UTSW 15 89335321 missense probably damaging 1.00
R6339:Miox UTSW 15 89335499 nonsense probably null
R7309:Miox UTSW 15 89336049 missense probably damaging 1.00
R7402:Miox UTSW 15 89335003 missense probably benign 0.01
R7891:Miox UTSW 15 89336539 missense probably benign 0.10
R7913:Miox UTSW 15 89336582 missense probably damaging 0.99
R7974:Miox UTSW 15 89336539 missense probably benign 0.10
R7994:Miox UTSW 15 89336582 missense probably damaging 0.99
Z1177:Miox UTSW 15 89335644 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTCTTTAGCCCTCACTCACAG -3'
(R):5'- CTCTGAAGGCAGGGAGAACTTGTTG -3'

Sequencing Primer
(F):5'- TGTTGGAGACACGTTCCC -3'
(R):5'- CAGGGAGAACTTGTTGAACTTCATC -3'
Posted On2014-01-10