Incidental Mutation 'R0102:Tbc1d9b'
ID99006
Institutional Source Beutler Lab
Gene Symbol Tbc1d9b
Ensembl Gene ENSMUSG00000036644
Gene NameTBC1 domain family, member 9B
Synonyms2700008N14Rik
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R0102 (G1)
Quality Score33
Status Validated
Chromosome11
Chromosomal Location50131396-50172785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50135849 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 48 (V48A)
Ref Sequence ENSEMBL: ENSMUSP00000098828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093138] [ENSMUST00000101270]
Predicted Effect probably damaging
Transcript: ENSMUST00000093138
AA Change: V48A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090825
Gene: ENSMUSG00000036644
AA Change: V48A

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 2e-28 BLAST
low complexity region 1124 1138 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101270
AA Change: V48A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098828
Gene: ENSMUSG00000036644
AA Change: V48A

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 3e-28 BLAST
low complexity region 970 980 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
low complexity region 1161 1172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147628
Meta Mutation Damage Score 0.1959 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Tbc1d9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tbc1d9b APN 11 50161633 missense probably damaging 1.00
IGL01870:Tbc1d9b APN 11 50162088 missense probably damaging 1.00
IGL02082:Tbc1d9b APN 11 50163882 missense probably benign 0.00
IGL02105:Tbc1d9b APN 11 50149826 missense probably damaging 0.96
IGL02264:Tbc1d9b APN 11 50149757 missense probably damaging 0.98
IGL02801:Tbc1d9b APN 11 50152830 missense probably damaging 1.00
IGL03111:Tbc1d9b APN 11 50158542 missense probably damaging 1.00
IGL02988:Tbc1d9b UTSW 11 50151946 missense possibly damaging 0.80
R0109:Tbc1d9b UTSW 11 50158434 missense probably benign 0.02
R0131:Tbc1d9b UTSW 11 50135924 missense probably benign
R0463:Tbc1d9b UTSW 11 50145067 missense probably benign 0.00
R0472:Tbc1d9b UTSW 11 50168228 splice site probably null
R0846:Tbc1d9b UTSW 11 50171321 missense probably benign 0.01
R1099:Tbc1d9b UTSW 11 50146308 missense probably benign 0.04
R1276:Tbc1d9b UTSW 11 50152649 missense possibly damaging 0.87
R1642:Tbc1d9b UTSW 11 50149832 missense probably damaging 0.98
R2679:Tbc1d9b UTSW 11 50161701 splice site probably null
R2915:Tbc1d9b UTSW 11 50149736 missense possibly damaging 0.95
R3825:Tbc1d9b UTSW 11 50171127 missense possibly damaging 0.85
R3964:Tbc1d9b UTSW 11 50168696 missense possibly damaging 0.50
R4051:Tbc1d9b UTSW 11 50171243 missense probably benign 0.09
R4705:Tbc1d9b UTSW 11 50140462 missense probably benign 0.33
R4783:Tbc1d9b UTSW 11 50171298 missense probably benign 0.00
R5330:Tbc1d9b UTSW 11 50146313 missense probably benign
R5331:Tbc1d9b UTSW 11 50146313 missense probably benign
R5888:Tbc1d9b UTSW 11 50140484 missense probably benign 0.15
R5949:Tbc1d9b UTSW 11 50148049 missense probably benign
R6144:Tbc1d9b UTSW 11 50146328 missense probably benign
R6166:Tbc1d9b UTSW 11 50135846 missense probably damaging 1.00
R6331:Tbc1d9b UTSW 11 50131497 missense possibly damaging 0.95
R6432:Tbc1d9b UTSW 11 50146328 missense probably benign
R6856:Tbc1d9b UTSW 11 50168746 missense probably benign 0.11
R7110:Tbc1d9b UTSW 11 50163830 missense probably benign 0.09
R7134:Tbc1d9b UTSW 11 50152692 missense possibly damaging 0.55
R7372:Tbc1d9b UTSW 11 50168688 splice site probably null
R7464:Tbc1d9b UTSW 11 50131485 missense probably damaging 1.00
R7508:Tbc1d9b UTSW 11 50145120 missense probably damaging 0.97
R7584:Tbc1d9b UTSW 11 50170716 missense probably damaging 1.00
R7730:Tbc1d9b UTSW 11 50135915 missense possibly damaging 0.89
R7747:Tbc1d9b UTSW 11 50161620 missense probably benign 0.39
R7963:Tbc1d9b UTSW 11 50168109 intron probably null
X0065:Tbc1d9b UTSW 11 50168183 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTTGAGTCCCATGAAGCAAACATC -3'
(R):5'- CCCCATCAAGAATGCAGGTTTCCTGTC -3'

Sequencing Primer
(F):5'- cccaggaaacagaggcag -3'
(R):5'- GTCCCTCCCAGTGTAACTTC -3'
Posted On2014-01-10