Incidental Mutation 'R0102:Fam171a2'
ID99007
Institutional Source Beutler Lab
Gene Symbol Fam171a2
Ensembl Gene ENSMUSG00000034685
Gene Namefamily with sequence similarity 171, member A2
Synonyms
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0102 (G1)
Quality Score30
Status Validated
Chromosome11
Chromosomal Location102436981-102447682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102444113 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 66 (N66S)
Ref Sequence ENSEMBL: ENSMUSP00000038486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049057
AA Change: N66S

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685
AA Change: N66S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152015
Meta Mutation Damage Score 0.4216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Fam171a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Fam171a2 APN 11 102437848 missense possibly damaging 0.92
IGL01898:Fam171a2 APN 11 102439756 missense possibly damaging 0.88
IGL02477:Fam171a2 APN 11 102440028 missense probably benign 0.00
IGL03272:Fam171a2 APN 11 102444118 missense possibly damaging 0.58
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0632:Fam171a2 UTSW 11 102437881 missense probably damaging 0.99
R0733:Fam171a2 UTSW 11 102439722 missense possibly damaging 0.83
R1005:Fam171a2 UTSW 11 102440181 missense probably benign 0.05
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R2425:Fam171a2 UTSW 11 102438361 missense possibly damaging 0.88
R4838:Fam171a2 UTSW 11 102438685 missense possibly damaging 0.88
R4858:Fam171a2 UTSW 11 102440156 missense probably damaging 1.00
R5119:Fam171a2 UTSW 11 102438733 missense probably damaging 0.97
R5384:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5386:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5408:Fam171a2 UTSW 11 102437518 missense possibly damaging 0.71
R5457:Fam171a2 UTSW 11 102437536 missense possibly damaging 0.92
R5732:Fam171a2 UTSW 11 102439981 missense possibly damaging 0.94
R6466:Fam171a2 UTSW 11 102439885 missense probably damaging 1.00
R6931:Fam171a2 UTSW 11 102438434 missense possibly damaging 0.95
R7196:Fam171a2 UTSW 11 102438346 missense probably benign 0.04
R7261:Fam171a2 UTSW 11 102438074 missense probably damaging 0.98
R7295:Fam171a2 UTSW 11 102438238 missense possibly damaging 0.85
R7419:Fam171a2 UTSW 11 102438802 missense possibly damaging 0.95
R7422:Fam171a2 UTSW 11 102438665 missense probably benign 0.29
R7454:Fam171a2 UTSW 11 102439717 missense possibly damaging 0.88
R7606:Fam171a2 UTSW 11 102444176 missense possibly damaging 0.75
R7690:Fam171a2 UTSW 11 102437834 missense probably benign 0.04
R7754:Fam171a2 UTSW 11 102438563 missense probably benign 0.00
R8060:Fam171a2 UTSW 11 102438610 missense possibly damaging 0.88
Z1176:Fam171a2 UTSW 11 102447446 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGCAAGGACTATTTTGGGAAGGG -3'
(R):5'- GCTGATTTTGGCAGAGAGCACAAC -3'

Sequencing Primer
(F):5'- AGCTGCTGTCCAACCCG -3'
(R):5'- AGACAGAGGCCCTACATTTG -3'
Posted On2014-01-10