Incidental Mutation 'R0102:Golgb1'
ID 99010
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 038388-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R0102 (G1)
Quality Score 56
Status Validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) C to A at 36695830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023534] [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114812] [ENSMUST00000114819] [ENSMUST00000134616] [ENSMUST00000135406]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023534
AA Change: Q110K
SMART Domains Protein: ENSMUSP00000023534
Gene: ENSMUSG00000034243
AA Change: Q110K

DomainStartEndE-ValueType
low complexity region 55 99 N/A INTRINSIC
low complexity region 109 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023535
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114819
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect probably benign
Transcript: ENSMUST00000134616
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135406
SMART Domains Protein: ENSMUSP00000115848
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,874 (GRCm39) K1021R probably damaging Het
2610528J11Rik G A 4: 118,386,762 (GRCm39) V36M probably damaging Het
4930402F06Rik T A 2: 35,265,795 (GRCm39) R292* probably null Het
Abcb4 T C 5: 8,959,194 (GRCm39) F207S probably damaging Het
Afap1l2 G T 19: 56,916,872 (GRCm39) probably benign Het
Arfgef2 A T 2: 166,687,385 (GRCm39) H203L probably benign Het
Cfi A C 3: 129,642,416 (GRCm39) H90P probably damaging Het
Col1a2 T A 6: 4,520,775 (GRCm39) S371T possibly damaging Het
Cyp2d10 C T 15: 82,288,794 (GRCm39) M229I probably benign Het
Dnah5 A G 15: 28,245,897 (GRCm39) probably benign Het
Dnttip2 G T 3: 122,069,452 (GRCm39) M222I probably benign Het
Dync1li2 A T 8: 105,154,757 (GRCm39) Y284N probably benign Het
Ebf1 T C 11: 44,882,282 (GRCm39) Y413H probably benign Het
Exog A G 9: 119,281,319 (GRCm39) T186A possibly damaging Het
Fam171a2 T C 11: 102,334,939 (GRCm39) N66S possibly damaging Het
Gad1 G A 2: 70,417,583 (GRCm39) probably null Het
Gprc5a A T 6: 135,056,033 (GRCm39) N160I probably damaging Het
Haus3 A G 5: 34,323,258 (GRCm39) probably null Het
Klhl20 A T 1: 160,918,015 (GRCm39) C90* probably null Het
Krt84 T A 15: 101,437,138 (GRCm39) I342L probably damaging Het
Lifr G A 15: 7,208,373 (GRCm39) D584N probably damaging Het
Lrp1b G A 2: 41,298,997 (GRCm39) probably benign Het
Lrtm1 T A 14: 28,744,184 (GRCm39) probably benign Het
Med25 C T 7: 44,534,904 (GRCm39) V80I possibly damaging Het
Mest A G 6: 30,746,269 (GRCm39) I279V probably damaging Het
Mki67 T C 7: 135,315,532 (GRCm39) R81G probably benign Het
Naa25 A G 5: 121,573,632 (GRCm39) D787G possibly damaging Het
Naaladl1 C T 19: 6,162,534 (GRCm39) P465S probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Necab3 G A 2: 154,387,232 (GRCm39) R302C probably damaging Het
Nsg1 A T 5: 38,316,254 (GRCm39) D32E probably damaging Het
Nuggc A G 14: 65,851,000 (GRCm39) D290G probably null Het
Nup205 A T 6: 35,202,715 (GRCm39) probably benign Het
Or11g27 T A 14: 50,771,088 (GRCm39) L73Q probably damaging Het
Or2w6 T C 13: 21,842,905 (GRCm39) D196G probably damaging Het
Or4a77 T C 2: 89,486,999 (GRCm39) N262S probably benign Het
Or4c111 T C 2: 88,844,015 (GRCm39) Y131C probably damaging Het
Or4f57 G C 2: 111,790,942 (GRCm39) Q159E probably damaging Het
Or8h10 A T 2: 86,808,549 (GRCm39) I197N possibly damaging Het
Otp T C 13: 95,013,663 (GRCm39) V27A probably benign Het
Phip A T 9: 82,787,845 (GRCm39) probably null Het
Pon2 A G 6: 5,289,091 (GRCm39) probably benign Het
Ppp1r12b T A 1: 134,763,637 (GRCm39) probably null Het
Ppp1r15b A G 1: 133,060,908 (GRCm39) N475S probably damaging Het
Prrt3 A T 6: 113,474,790 (GRCm39) L144H probably damaging Het
Psmb7 A G 2: 38,533,377 (GRCm39) V50A possibly damaging Het
Sacs T A 14: 61,442,017 (GRCm39) S1354R probably damaging Het
Sdcbp2 A G 2: 151,425,884 (GRCm39) T29A probably benign Het
Shbg T A 11: 69,508,415 (GRCm39) probably benign Het
Shcbp1 A G 8: 4,794,452 (GRCm39) I447T probably damaging Het
Tbc1d9b T C 11: 50,026,676 (GRCm39) V48A probably damaging Het
Thbd A T 2: 148,248,903 (GRCm39) C322S probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trappc12 A T 12: 28,796,751 (GRCm39) F260L probably damaging Het
Trim10 C A 17: 37,181,074 (GRCm39) H102N probably damaging Het
Ube2u A G 4: 100,407,122 (GRCm39) T215A possibly damaging Het
Vcan T G 13: 89,851,787 (GRCm39) T1058P probably benign Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGTTAGTTACAAACAAGGCGTG -3'
(R):5'- AACAGCAGGATCATTCGTGGGC -3'

Sequencing Primer
(F):5'- TGGTTCCCATAGCAACGC -3'
(R):5'- ATCATTCGTGGGCCTCGAC -3'
Posted On 2014-01-10