Incidental Mutation 'R0102:Tnfrsf21'
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0102 (G1)
Quality Score78
Status Validated
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43038213 bp
Amino Acid Change Histidine to Tyrosine at position 239 (H239Y)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
R8495:Tnfrsf21 UTSW 17 43038237 missense probably benign
R8865:Tnfrsf21 UTSW 17 43085481 missense probably damaging 1.00
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acaactaaaatcactcaactcactc -3'
Posted On2014-01-10