Mutagenetix > Incidental Mutation

Incidental Mutation 'R0774:St5'

99105

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

MMRRC Submission

038954-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.430) question?

Stock #

R0774 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 109542320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000168005]

AlphaFold

Q924W7

Predicted Effect

probably null
Transcript: ENSMUST00000077909

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000077909

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079282

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079282

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000084738

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000084738

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000168005

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000168005

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208557

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.8%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 7 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdhr2	C	T	13: 54,717,855	S222F	probably damaging	Het
Leng8	T	A	7: 4,142,136	H178Q	probably damaging	Het
Prl3b1	G	A	13: 27,243,865	A53T	probably benign	Het
Psip1	CACTTACT	CACT	4: 83,460,452		probably null	Het
Shox2	C	T	3: 66,973,811	A279T	probably damaging	Het
Sis	T	C	3: 72,952,531	Q297R	probably damaging	Het
Slc1a6	G	T	10: 78,812,824	V460L	probably benign	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
R9016:St5	UTSW	7	109540435	missense	possibly damaging	0.84
R9178:St5	UTSW	7	109557084	missense	probably benign	0.31
R9361:St5	UTSW	7	109527784	missense	probably damaging	1.00
R9564:St5	UTSW	7	109526329	missense	probably damaging	1.00
R9595:St5	UTSW	7	109556766	missense	probably damaging	0.96
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCAAGAGTCATTGAACCAACGGAG -3'
(R):5'- GCCACGATTACCCAAGAGGCATAG -3'

Sequencing Primer
(F):5'- TAAGAGAGTCTCAGCTCAGCTAGTC -3'
(R):5'- CATAGCCATGATGACATGATGC -3'

Posted On

2014-01-10