Mutagenetix > Incidental Mutation

Incidental Mutation 'R0774:Dennd2b'

99105

Institutional Source

Beutler Lab

Gene Symbol

Dennd2b

Ensembl Gene

ENSMUSG00000031024

Gene Name

DENN domain containing 2B

Synonyms

Denn2b, 2610305K15Rik, St5, 2010004M01Rik

MMRRC Submission

038954-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.390) question?

Stock #

R0774 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109123118-109302812 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 109141527 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000168005]

AlphaFold

Q924W7

Predicted Effect

probably null
Transcript: ENSMUST00000077909

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000077909

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079282

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079282

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000084738

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000084738

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000168005

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000168005

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208557

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.8%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 7 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdhr2	C	T	13: 54,865,668 (GRCm39)	S222F	probably damaging	Het
Leng8	T	A	7: 4,145,135 (GRCm39)	H178Q	probably damaging	Het
Prl3b1	G	A	13: 27,427,848 (GRCm39)	A53T	probably benign	Het
Psip1	CACTTACT	CACT	4: 83,378,689 (GRCm39)		probably null	Het
Shox2	C	T	3: 66,881,144 (GRCm39)	A279T	probably damaging	Het
Sis	T	C	3: 72,859,864 (GRCm39)	Q297R	probably damaging	Het
Slc1a6	G	T	10: 78,648,658 (GRCm39)	V460L	probably benign	Het

Other mutations in Dennd2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Dennd2b	APN	7	109,126,915 (GRCm39)	missense	possibly damaging	0.71
IGL01132:Dennd2b	APN	7	109,169,212 (GRCm39)	splice site	probably null
IGL01288:Dennd2b	APN	7	109,139,029 (GRCm39)	missense	probably damaging	0.96
IGL01645:Dennd2b	APN	7	109,126,841 (GRCm39)	nonsense	probably null
IGL01714:Dennd2b	APN	7	109,169,269 (GRCm39)	missense	probably damaging	0.99
IGL02021:Dennd2b	APN	7	109,156,579 (GRCm39)	missense	probably damaging	1.00
IGL02302:Dennd2b	APN	7	109,124,538 (GRCm39)	missense	probably damaging	1.00
IGL02496:Dennd2b	APN	7	109,155,442 (GRCm39)	missense	possibly damaging	0.83
IGL02795:Dennd2b	APN	7	109,155,571 (GRCm39)	missense	probably damaging	1.00
Bucolic	UTSW	7	109,124,755 (GRCm39)	nonsense	probably null
Halcyon	UTSW	7	109,156,000 (GRCm39)	nonsense	probably null
FR4340:Dennd2b	UTSW	7	109,156,128 (GRCm39)	unclassified	probably benign
FR4737:Dennd2b	UTSW	7	109,156,128 (GRCm39)	unclassified	probably benign
PIT4466001:Dennd2b	UTSW	7	109,130,337 (GRCm39)	missense	probably damaging	1.00
PIT4469001:Dennd2b	UTSW	7	109,130,337 (GRCm39)	missense	probably damaging	1.00
PIT4472001:Dennd2b	UTSW	7	109,130,337 (GRCm39)	missense	probably damaging	1.00
R0024:Dennd2b	UTSW	7	109,123,866 (GRCm39)	missense	probably damaging	1.00
R0124:Dennd2b	UTSW	7	109,141,718 (GRCm39)	missense	possibly damaging	0.66
R0125:Dennd2b	UTSW	7	109,155,545 (GRCm39)	missense	probably benign	0.19
R0365:Dennd2b	UTSW	7	109,138,156 (GRCm39)	missense	probably damaging	1.00
R0491:Dennd2b	UTSW	7	109,156,411 (GRCm39)	missense	probably benign	0.45
R0534:Dennd2b	UTSW	7	109,140,635 (GRCm39)	missense	probably damaging	1.00
R0662:Dennd2b	UTSW	7	109,156,633 (GRCm39)	missense	probably damaging	1.00
R0743:Dennd2b	UTSW	7	109,156,552 (GRCm39)	missense	probably damaging	1.00
R0772:Dennd2b	UTSW	7	109,141,527 (GRCm39)	splice site	probably null
R0787:Dennd2b	UTSW	7	109,124,827 (GRCm39)	missense	possibly damaging	0.94
R0884:Dennd2b	UTSW	7	109,156,552 (GRCm39)	missense	probably damaging	1.00
R1518:Dennd2b	UTSW	7	109,156,562 (GRCm39)	missense	probably damaging	1.00
R1908:Dennd2b	UTSW	7	109,124,533 (GRCm39)	nonsense	probably null
R1909:Dennd2b	UTSW	7	109,124,533 (GRCm39)	nonsense	probably null
R2232:Dennd2b	UTSW	7	109,156,414 (GRCm39)	missense	probably benign
R2358:Dennd2b	UTSW	7	109,155,653 (GRCm39)	missense	probably benign	0.01
R2847:Dennd2b	UTSW	7	109,124,544 (GRCm39)	missense	probably damaging	1.00
R2869:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R2869:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R2870:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R2870:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R2871:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R2871:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R2873:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R2874:Dennd2b	UTSW	7	109,156,637 (GRCm39)	missense	probably benign	0.01
R4534:Dennd2b	UTSW	7	109,130,363 (GRCm39)	missense	probably damaging	1.00
R4536:Dennd2b	UTSW	7	109,130,363 (GRCm39)	missense	probably damaging	1.00
R4559:Dennd2b	UTSW	7	109,124,785 (GRCm39)	missense	probably damaging	1.00
R4798:Dennd2b	UTSW	7	109,156,240 (GRCm39)	missense	probably damaging	0.99
R4846:Dennd2b	UTSW	7	109,156,043 (GRCm39)	nonsense	probably null
R5110:Dennd2b	UTSW	7	109,141,697 (GRCm39)	missense	probably benign	0.02
R5181:Dennd2b	UTSW	7	109,155,997 (GRCm39)	missense	probably benign
R5268:Dennd2b	UTSW	7	109,156,519 (GRCm39)	missense	probably benign
R5403:Dennd2b	UTSW	7	109,156,112 (GRCm39)	missense	probably damaging	1.00
R5836:Dennd2b	UTSW	7	109,140,552 (GRCm39)	missense	possibly damaging	0.78
R5932:Dennd2b	UTSW	7	109,169,223 (GRCm39)	missense	probably damaging	1.00
R5937:Dennd2b	UTSW	7	109,156,478 (GRCm39)	missense	possibly damaging	0.86
R6180:Dennd2b	UTSW	7	109,156,095 (GRCm39)	missense	probably benign	0.11
R6741:Dennd2b	UTSW	7	109,144,304 (GRCm39)	missense	possibly damaging	0.95
R6781:Dennd2b	UTSW	7	109,124,511 (GRCm39)	missense	possibly damaging	0.83
R7086:Dennd2b	UTSW	7	109,124,781 (GRCm39)	missense	probably damaging	1.00
R7466:Dennd2b	UTSW	7	109,124,553 (GRCm39)	missense	probably damaging	1.00
R7644:Dennd2b	UTSW	7	109,156,000 (GRCm39)	nonsense	probably null
R8354:Dennd2b	UTSW	7	109,124,755 (GRCm39)	nonsense	probably null
R8745:Dennd2b	UTSW	7	109,156,279 (GRCm39)	missense	probably benign	0.02
R8859:Dennd2b	UTSW	7	109,123,863 (GRCm39)	missense	probably damaging	1.00
R9016:Dennd2b	UTSW	7	109,139,642 (GRCm39)	missense	possibly damaging	0.84
R9178:Dennd2b	UTSW	7	109,156,291 (GRCm39)	missense	probably benign	0.31
R9361:Dennd2b	UTSW	7	109,126,991 (GRCm39)	missense	probably damaging	1.00
R9564:Dennd2b	UTSW	7	109,125,536 (GRCm39)	missense	probably damaging	1.00
R9595:Dennd2b	UTSW	7	109,155,973 (GRCm39)	missense	probably damaging	0.96
RF062:Dennd2b	UTSW	7	109,156,153 (GRCm39)	unclassified	probably benign
X0067:Dennd2b	UTSW	7	109,155,447 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCAAGAGTCATTGAACCAACGGAG -3'
(R):5'- GCCACGATTACCCAAGAGGCATAG -3'

Sequencing Primer
(F):5'- TAAGAGAGTCTCAGCTCAGCTAGTC -3'
(R):5'- CATAGCCATGATGACATGATGC -3'

Posted On

2014-01-10