Incidental Mutation 'R1212:Vmn1r64'
ID99442
Institutional Source Beutler Lab
Gene Symbol Vmn1r64
Ensembl Gene ENSMUSG00000058399
Gene Namevomeronasal 1 receptor 64
SynonymsV1rd11
MMRRC Submission 039281-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1212 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5883580-5884590 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5884211 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 111 (S111N)
Ref Sequence ENSEMBL: ENSMUSP00000077568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078475]
Predicted Effect probably damaging
Transcript: ENSMUST00000078475
AA Change: S111N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077568
Gene: ENSMUSG00000058399
AA Change: S111N

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 3.3e-13 PFAM
Pfam:V1R 41 296 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 82.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambra1 G A 2: 91,769,036 R167H possibly damaging Het
Ankrd50 G A 3: 38,455,687 R844C probably damaging Het
Arfgef1 T C 1: 10,216,559 E42G probably benign Het
Arhgap42 T A 9: 9,015,312 I444F probably damaging Het
BC067074 G A 13: 113,369,417 probably benign Het
Il25 G A 14: 54,932,755 probably benign Het
Jak1 A G 4: 101,189,094 L105P probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Ralgapa2 A G 2: 146,357,982 V1214A probably benign Het
Shtn1 T C 19: 59,050,890 D39G probably damaging Het
Supt16 G A 14: 52,174,124 R601* probably null Het
Ttc26 A G 6: 38,410,793 D393G probably damaging Het
Ttc30a2 A T 2: 75,976,479 I563N probably damaging Het
Vmn1r113 A T 7: 20,787,431 R49S probably benign Het
Other mutations in Vmn1r64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Vmn1r64 APN 7 5883828 missense probably damaging 0.98
IGL01070:Vmn1r64 APN 7 5883942 missense probably benign 0.04
IGL01817:Vmn1r64 APN 7 5884223 missense probably damaging 1.00
IGL02026:Vmn1r64 APN 7 5883650 missense possibly damaging 0.84
IGL02657:Vmn1r64 APN 7 5883728 missense probably benign 0.33
IGL03352:Vmn1r64 APN 7 5884071 missense probably benign 0.12
R0200:Vmn1r64 UTSW 7 5883818 missense probably benign 0.38
R0540:Vmn1r64 UTSW 7 5884097 missense probably damaging 1.00
R0655:Vmn1r64 UTSW 7 5884208 missense probably benign 0.25
R1579:Vmn1r64 UTSW 7 5883804 missense probably damaging 1.00
R2034:Vmn1r64 UTSW 7 5883989 missense probably benign 0.09
R2221:Vmn1r64 UTSW 7 5884449 missense probably benign 0.00
R2240:Vmn1r64 UTSW 7 5884370 nonsense probably null
R2305:Vmn1r64 UTSW 7 5884536 missense probably benign 0.04
R3019:Vmn1r64 UTSW 7 5884227 missense probably damaging 1.00
R4256:Vmn1r64 UTSW 7 5883896 missense probably benign 0.05
R4666:Vmn1r64 UTSW 7 5884358 missense probably damaging 0.99
R4996:Vmn1r64 UTSW 7 5884053 missense probably benign 0.03
R5682:Vmn1r64 UTSW 7 5883623 missense possibly damaging 0.79
R5730:Vmn1r64 UTSW 7 5884523 missense probably benign 0.01
R7397:Vmn1r64 UTSW 7 5884014 missense possibly damaging 0.87
X0063:Vmn1r64 UTSW 7 5884350 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCCCAGAGATGGAGCATATCC -3'
(R):5'- AGTCTTGACTGACTCCCGACTGAG -3'

Sequencing Primer
(F):5'- CAGAGATGGAGCATATCCAATTGTC -3'
(R):5'- TGAGGCCCATACAGGTCATTC -3'
Posted On2014-01-15