Incidental Mutation 'R1212:Shtn1'
ID99460
Institutional Source Beutler Lab
Gene Symbol Shtn1
Ensembl Gene ENSMUSG00000041362
Gene Nameshootin 1
Synonyms4930506M07Rik, shootin1
MMRRC Submission 039281-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1212 (G1)
Quality Score163
Status Not validated
Chromosome19
Chromosomal Location58973358-59076069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59050890 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 39 (D39G)
Ref Sequence ENSEMBL: ENSMUSP00000126227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000163821]
Predicted Effect probably damaging
Transcript: ENSMUST00000047511
AA Change: D39G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362
AA Change: D39G

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163821
AA Change: D39G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362
AA Change: D39G

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 82.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambra1 G A 2: 91,769,036 R167H possibly damaging Het
Ankrd50 G A 3: 38,455,687 R844C probably damaging Het
Arfgef1 T C 1: 10,216,559 E42G probably benign Het
Arhgap42 T A 9: 9,015,312 I444F probably damaging Het
BC067074 G A 13: 113,369,417 probably benign Het
Il25 G A 14: 54,932,755 probably benign Het
Jak1 A G 4: 101,189,094 L105P probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Ralgapa2 A G 2: 146,357,982 V1214A probably benign Het
Supt16 G A 14: 52,174,124 R601* probably null Het
Ttc26 A G 6: 38,410,793 D393G probably damaging Het
Ttc30a2 A T 2: 75,976,479 I563N probably damaging Het
Vmn1r113 A T 7: 20,787,431 R49S probably benign Het
Vmn1r64 C T 7: 5,884,211 S111N probably damaging Het
Other mutations in Shtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Shtn1 APN 19 59018952 missense possibly damaging 0.56
IGL01619:Shtn1 APN 19 59028169 missense probably damaging 0.99
IGL01880:Shtn1 APN 19 59075449 splice site probably benign
IGL02214:Shtn1 APN 19 58999886 splice site probably benign
IGL03400:Shtn1 APN 19 59032258 splice site probably benign
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0299:Shtn1 UTSW 19 59018951 missense probably benign 0.00
R0606:Shtn1 UTSW 19 58999940 missense probably damaging 0.99
R1081:Shtn1 UTSW 19 58975015 missense probably benign 0.04
R1677:Shtn1 UTSW 19 59009790 missense probably damaging 1.00
R1791:Shtn1 UTSW 19 59032200 missense probably damaging 0.99
R1966:Shtn1 UTSW 19 58975038 missense probably benign
R3076:Shtn1 UTSW 19 58995086 missense probably damaging 1.00
R3552:Shtn1 UTSW 19 58975038 missense probably benign 0.28
R3736:Shtn1 UTSW 19 59022268 missense probably benign
R4615:Shtn1 UTSW 19 59022216 missense probably benign 0.18
R4789:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4791:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4792:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4939:Shtn1 UTSW 19 59022201 missense probably benign 0.00
R5245:Shtn1 UTSW 19 59032220 missense possibly damaging 0.90
R5387:Shtn1 UTSW 19 59038369 missense probably damaging 1.00
R5813:Shtn1 UTSW 19 59032241 missense probably damaging 1.00
R6013:Shtn1 UTSW 19 58975101 missense probably damaging 1.00
R6374:Shtn1 UTSW 19 59038296 missense possibly damaging 0.94
R7030:Shtn1 UTSW 19 59009834 missense possibly damaging 0.74
R7143:Shtn1 UTSW 19 59018906 missense probably damaging 0.99
R7487:Shtn1 UTSW 19 59003860 missense probably damaging 0.99
R7496:Shtn1 UTSW 19 59028184 missense probably damaging 1.00
R7889:Shtn1 UTSW 19 59003896 missense probably damaging 0.99
R8209:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8226:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8290:Shtn1 UTSW 19 58999894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTTCTCAGGGAGTAAAGGTAACC -3'
(R):5'- TCACACTAGGCCAGTCGCACTA -3'

Sequencing Primer
(F):5'- AGCCATGCCAGAGCATTTTTATTC -3'
(R):5'- AAAAGTGTCACTGCTGTGGG -3'
Posted On2014-01-15