Incidental Mutation 'R1213:Olfr215'
ID99479
Institutional Source Beutler Lab
Gene Symbol Olfr215
Ensembl Gene ENSMUSG00000050654
Gene Nameolfactory receptor 215
SynonymsMOR119-2, GA_x54KRFPKN04-58217732-58216800
MMRRC Submission 039282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1213 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116580084-116584195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116582866 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 27 (S27P)
Ref Sequence ENSEMBL: ENSMUSP00000052425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061723]
Predicted Effect probably benign
Transcript: ENSMUST00000061723
AA Change: S27P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052425
Gene: ENSMUSG00000050654
AA Change: S27P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 258 1.8e-5 PFAM
Pfam:7tm_1 39 288 2.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.2%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,157,673 S2149P probably damaging Het
Agfg1 T C 1: 82,875,334 S142P probably damaging Het
Appl1 G A 14: 26,943,993 A388V probably benign Het
Atp11a A G 8: 12,842,859 R70G probably benign Het
Atrnl1 G A 19: 57,638,462 V167I probably benign Het
Bfar T C 16: 13,687,444 I106T possibly damaging Het
Cbx8 T C 11: 119,039,533 probably null Het
Cd80 T C 16: 38,473,883 S43P probably damaging Het
E330017A01Rik A T 16: 58,637,694 Y81* probably null Het
Fat4 G A 3: 38,890,371 A1138T probably benign Het
Fmo3 C A 1: 162,967,823 G148W probably damaging Het
Krt78 T C 15: 101,951,810 M224V probably benign Het
Moxd2 A G 6: 40,891,897 probably benign Het
Olfr1384 T A 11: 49,514,594 *319K probably null Het
Olfr702 T A 7: 106,824,197 T110S possibly damaging Het
Pax6 G A 2: 105,685,913 G179R probably benign Het
Rbm12 G A 2: 156,097,492 Q287* probably null Het
Rtel1 T A 2: 181,351,335 H703Q probably benign Het
Spag17 A G 3: 100,095,638 R1893G probably benign Het
Synpo A G 18: 60,602,453 V807A possibly damaging Het
Other mutations in Olfr215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Olfr215 APN 6 116582335 missense possibly damaging 0.93
IGL02959:Olfr215 APN 6 116582544 missense probably damaging 1.00
IGL03053:Olfr215 APN 6 116582245 missense possibly damaging 0.50
R0078:Olfr215 UTSW 6 116582740 missense probably damaging 0.96
R0277:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0323:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0399:Olfr215 UTSW 6 116582781 missense probably benign 0.00
R0545:Olfr215 UTSW 6 116582656 missense probably benign 0.01
R1775:Olfr215 UTSW 6 116582964 start gained probably benign
R1789:Olfr215 UTSW 6 116582697 missense probably damaging 1.00
R4724:Olfr215 UTSW 6 116582937 missense probably damaging 1.00
R5391:Olfr215 UTSW 6 116582847 missense probably damaging 1.00
R5392:Olfr215 UTSW 6 116582418 missense probably damaging 1.00
R5686:Olfr215 UTSW 6 116582929 missense probably benign 0.00
R6124:Olfr215 UTSW 6 116582485 missense probably benign 0.05
R7080:Olfr215 UTSW 6 116582353 missense probably damaging 1.00
R7355:Olfr215 UTSW 6 116582955 start gained probably benign
Z1177:Olfr215 UTSW 6 116582553 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGAGGCTTGCAAATAGCTACAC -3'
(R):5'- ACCTTGAACAGGCTGCTGAATGAC -3'

Sequencing Primer
(F):5'- TGTCCACTGACATCACAGCTATG -3'
(R):5'- GCTGCTGAATGACCTCATTG -3'
Posted On2014-01-15