Incidental Mutation 'R1213:Appl1'
ID 99491
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms 7330406P05Rik, 2900057D21Rik
MMRRC Submission 039282-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R1213 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 26640943-26692567 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26665950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 388 (A388V)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
AlphaFold Q8K3H0
Predicted Effect probably benign
Transcript: ENSMUST00000036570
AA Change: A388V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: A388V

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.2%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,853,055 (GRCm39) S142P probably damaging Het
Atp11a A G 8: 12,892,859 (GRCm39) R70G probably benign Het
Atrnl1 G A 19: 57,626,894 (GRCm39) V167I probably benign Het
Bfar T C 16: 13,505,308 (GRCm39) I106T possibly damaging Het
Cbx8 T C 11: 118,930,359 (GRCm39) probably null Het
Cd80 T C 16: 38,294,245 (GRCm39) S43P probably damaging Het
Fat4 G A 3: 38,944,520 (GRCm39) A1138T probably benign Het
Fcgbpl1 T C 7: 27,857,098 (GRCm39) S2149P probably damaging Het
Fmo3 C A 1: 162,795,392 (GRCm39) G148W probably damaging Het
Ftdc2 A T 16: 58,458,057 (GRCm39) Y81* probably null Het
Krt78 T C 15: 101,860,245 (GRCm39) M224V probably benign Het
Moxd2 A G 6: 40,868,831 (GRCm39) probably benign Het
Or13n4 T A 7: 106,423,404 (GRCm39) T110S possibly damaging Het
Or2y14 T A 11: 49,405,421 (GRCm39) *319K probably null Het
Or6d15 A G 6: 116,559,827 (GRCm39) S27P probably benign Het
Pax6 G A 2: 105,516,258 (GRCm39) G179R probably benign Het
Rbm12 G A 2: 155,939,412 (GRCm39) Q287* probably null Het
Rtel1 T A 2: 180,993,128 (GRCm39) H703Q probably benign Het
Spag17 A G 3: 100,002,954 (GRCm39) R1893G probably benign Het
Synpo A G 18: 60,735,525 (GRCm39) V807A possibly damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26,671,433 (GRCm39) missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26,681,427 (GRCm39) splice site probably benign
IGL01633:Appl1 APN 14 26,684,795 (GRCm39) missense probably damaging 0.99
IGL01945:Appl1 APN 14 26,650,612 (GRCm39) missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26,647,909 (GRCm39) splice site probably benign
IGL02650:Appl1 APN 14 26,672,665 (GRCm39) missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26,671,418 (GRCm39) missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26,673,473 (GRCm39) missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26,650,600 (GRCm39) missense probably damaging 1.00
R0183:Appl1 UTSW 14 26,684,811 (GRCm39) missense probably damaging 1.00
R0323:Appl1 UTSW 14 26,664,695 (GRCm39) missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26,662,213 (GRCm39) missense probably benign
R1277:Appl1 UTSW 14 26,649,813 (GRCm39) missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26,645,811 (GRCm39) missense probably damaging 1.00
R1856:Appl1 UTSW 14 26,649,706 (GRCm39) missense probably damaging 1.00
R1889:Appl1 UTSW 14 26,647,470 (GRCm39) splice site probably benign
R2145:Appl1 UTSW 14 26,671,576 (GRCm39) missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3722:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3917:Appl1 UTSW 14 26,650,561 (GRCm39) missense probably damaging 1.00
R4700:Appl1 UTSW 14 26,647,928 (GRCm39) missense probably benign 0.00
R5139:Appl1 UTSW 14 26,669,112 (GRCm39) missense probably benign 0.04
R5485:Appl1 UTSW 14 26,684,823 (GRCm39) missense probably damaging 1.00
R5536:Appl1 UTSW 14 26,645,737 (GRCm39) nonsense probably null
R5795:Appl1 UTSW 14 26,664,773 (GRCm39) missense probably benign 0.01
R7044:Appl1 UTSW 14 26,650,634 (GRCm39) missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26,685,617 (GRCm39) missense probably benign 0.01
R7447:Appl1 UTSW 14 26,681,409 (GRCm39) nonsense probably null
R7943:Appl1 UTSW 14 26,667,525 (GRCm39) missense probably benign 0.01
R8110:Appl1 UTSW 14 26,649,751 (GRCm39) nonsense probably null
R8129:Appl1 UTSW 14 26,671,466 (GRCm39) missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26,650,592 (GRCm39) missense probably benign 0.35
R8211:Appl1 UTSW 14 26,667,555 (GRCm39) missense probably benign 0.18
R8239:Appl1 UTSW 14 26,686,914 (GRCm39) missense probably damaging 0.99
R8379:Appl1 UTSW 14 26,647,372 (GRCm39) critical splice donor site probably null
R8464:Appl1 UTSW 14 26,674,985 (GRCm39) nonsense probably null
R8699:Appl1 UTSW 14 26,662,212 (GRCm39) missense probably benign
R9023:Appl1 UTSW 14 26,685,652 (GRCm39) missense possibly damaging 0.93
R9090:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9203:Appl1 UTSW 14 26,682,970 (GRCm39) nonsense probably null
R9227:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9230:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9243:Appl1 UTSW 14 26,649,710 (GRCm39) missense possibly damaging 0.62
R9271:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9378:Appl1 UTSW 14 26,649,784 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCTGTGCCCTTATTAGGAAATG -3'
(R):5'- GTGTGCTAGGTGATAGCAGTACAAACC -3'

Sequencing Primer
(F):5'- atcctcctgcctctgcc -3'
(R):5'- GGTGATAGCAGTACAAACCTTAATCC -3'
Posted On 2014-01-15