Incidental Mutation 'R1213:Bfar'
ID 99497
Institutional Source Beutler Lab
Gene Symbol Bfar
Ensembl Gene ENSMUSG00000022684
Gene Name bifunctional apoptosis regulator
Synonyms 3010001A07Rik, RNF47
MMRRC Submission 039282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R1213 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 13671858-13703612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13687444 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 106 (I106T)
Ref Sequence ENSEMBL: ENSMUSP00000115585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023365] [ENSMUST00000069281] [ENSMUST00000127973]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023365
AA Change: I106T

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023365
Gene: ENSMUSG00000022684
AA Change: I106T

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
transmembrane domain 142 164 N/A INTRINSIC
SAM 179 249 1.82e-6 SMART
transmembrane domain 361 380 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069281
SMART Domains Protein: ENSMUSP00000063371
Gene: ENSMUSG00000022684

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
low complexity region 86 97 N/A INTRINSIC
PDB:1V85|A 98 123 2e-8 PDB
Blast:SAM 98 124 2e-8 BLAST
transmembrane domain 236 255 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127973
AA Change: I106T

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115585
Gene: ENSMUSG00000022684
AA Change: I106T

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
transmembrane domain 142 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154568
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.2%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,157,673 S2149P probably damaging Het
Agfg1 T C 1: 82,875,334 S142P probably damaging Het
Appl1 G A 14: 26,943,993 A388V probably benign Het
Atp11a A G 8: 12,842,859 R70G probably benign Het
Atrnl1 G A 19: 57,638,462 V167I probably benign Het
Cbx8 T C 11: 119,039,533 probably null Het
Cd80 T C 16: 38,473,883 S43P probably damaging Het
E330017A01Rik A T 16: 58,637,694 Y81* probably null Het
Fat4 G A 3: 38,890,371 A1138T probably benign Het
Fmo3 C A 1: 162,967,823 G148W probably damaging Het
Krt78 T C 15: 101,951,810 M224V probably benign Het
Moxd2 A G 6: 40,891,897 probably benign Het
Olfr1384 T A 11: 49,514,594 *319K probably null Het
Olfr215 A G 6: 116,582,866 S27P probably benign Het
Olfr702 T A 7: 106,824,197 T110S possibly damaging Het
Pax6 G A 2: 105,685,913 G179R probably benign Het
Rbm12 G A 2: 156,097,492 Q287* probably null Het
Rtel1 T A 2: 181,351,335 H703Q probably benign Het
Spag17 A G 3: 100,095,638 R1893G probably benign Het
Synpo A G 18: 60,602,453 V807A possibly damaging Het
Other mutations in Bfar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Bfar APN 16 13698963 missense probably benign 0.03
IGL01067:Bfar APN 16 13685241 missense probably damaging 1.00
IGL01532:Bfar APN 16 13687387 splice site probably benign
IGL02727:Bfar APN 16 13688927 critical splice donor site probably null
IGL03189:Bfar APN 16 13687501 missense possibly damaging 0.89
R1167:Bfar UTSW 16 13698894 missense possibly damaging 0.92
R1620:Bfar UTSW 16 13688846 missense probably damaging 1.00
R1951:Bfar UTSW 16 13702106 missense probably damaging 0.99
R2193:Bfar UTSW 16 13697471 missense probably benign
R4578:Bfar UTSW 16 13687443 missense probably benign 0.20
R4789:Bfar UTSW 16 13685137 start codon destroyed probably null 0.99
R4819:Bfar UTSW 16 13687467 nonsense probably null
R5271:Bfar UTSW 16 13692397 intron probably benign
R6346:Bfar UTSW 16 13702133 missense probably damaging 0.99
R7186:Bfar UTSW 16 13692507 missense probably benign
R7758:Bfar UTSW 16 13702121 missense possibly damaging 0.66
X0021:Bfar UTSW 16 13687587 missense probably benign 0.25
Z1088:Bfar UTSW 16 13697460 missense probably damaging 0.99
Z1177:Bfar UTSW 16 13688810 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCTGTTTCCTTAGTGGTAGCACATAG -3'
(R):5'- ATCAGAAGAACTGACTTCAGAGGCAAC -3'

Sequencing Primer
(F):5'- CATAAAGCAGAACTCTTTGTTGCTC -3'
(R):5'- TTGACGCACGGTACAGATTAAAC -3'
Posted On 2014-01-15