Incidental Mutation 'R1213:E330017A01Rik'
ID 99501
Institutional Source Beutler Lab
Gene Symbol E330017A01Rik
Ensembl Gene ENSMUSG00000055789
Gene Name RIKEN cDNA E330017A01 gene
Synonyms
MMRRC Submission 039282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R1213 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 58635167-58638739 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 58637694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 81 (Y81*)
Ref Sequence ENSEMBL: ENSMUSP00000056475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053249]
AlphaFold Q8BU47
Predicted Effect probably null
Transcript: ENSMUST00000053249
AA Change: Y81*
SMART Domains Protein: ENSMUSP00000056475
Gene: ENSMUSG00000055789
AA Change: Y81*

DomainStartEndE-ValueType
Pfam:Ferritin 12 149 3.2e-11 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.2%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,157,673 S2149P probably damaging Het
Agfg1 T C 1: 82,875,334 S142P probably damaging Het
Appl1 G A 14: 26,943,993 A388V probably benign Het
Atp11a A G 8: 12,842,859 R70G probably benign Het
Atrnl1 G A 19: 57,638,462 V167I probably benign Het
Bfar T C 16: 13,687,444 I106T possibly damaging Het
Cbx8 T C 11: 119,039,533 probably null Het
Cd80 T C 16: 38,473,883 S43P probably damaging Het
Fat4 G A 3: 38,890,371 A1138T probably benign Het
Fmo3 C A 1: 162,967,823 G148W probably damaging Het
Krt78 T C 15: 101,951,810 M224V probably benign Het
Moxd2 A G 6: 40,891,897 probably benign Het
Olfr1384 T A 11: 49,514,594 *319K probably null Het
Olfr215 A G 6: 116,582,866 S27P probably benign Het
Olfr702 T A 7: 106,824,197 T110S possibly damaging Het
Pax6 G A 2: 105,685,913 G179R probably benign Het
Rbm12 G A 2: 156,097,492 Q287* probably null Het
Rtel1 T A 2: 181,351,335 H703Q probably benign Het
Spag17 A G 3: 100,095,638 R1893G probably benign Het
Synpo A G 18: 60,602,453 V807A possibly damaging Het
Other mutations in E330017A01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:E330017A01Rik APN 16 58635491 missense probably damaging 0.99
IGL00895:E330017A01Rik APN 16 58637696 missense probably benign 0.03
IGL03025:E330017A01Rik APN 16 58637713 missense probably damaging 0.99
R0833:E330017A01Rik UTSW 16 58635523 missense probably damaging 0.96
R0836:E330017A01Rik UTSW 16 58635523 missense probably damaging 0.96
R5817:E330017A01Rik UTSW 16 58636793 missense probably benign 0.22
R7122:E330017A01Rik UTSW 16 58637777 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGCATGTAACGTCCCTGAGTTTC -3'
(R):5'- GCCCACAGTTTCATGACTGGCAAG -3'

Sequencing Primer
(F):5'- tcctgatgtagagagcaccc -3'
(R):5'- TTTCATGACTGGCAAGAAGGAG -3'
Posted On 2014-01-15