Mutagenetix > Incidental Mutations

Incidental Mutation 'R1213:Atrnl1'

99505

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

MMRRC Submission

039282-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R1213 (G1)

Quality Score

177

Status

Not validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 57638462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 167 (V167I)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

AlphaFold

Q6A051

Predicted Effect

probably benign
Transcript: ENSMUST00000077282
AA Change: V167I

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: V167I

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.3%
10x: 95.2%
20x: 87.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	C	7: 28,157,673	S2149P	probably damaging	Het
Agfg1	T	C	1: 82,875,334	S142P	probably damaging	Het
Appl1	G	A	14: 26,943,993	A388V	probably benign	Het
Atp11a	A	G	8: 12,842,859	R70G	probably benign	Het
Bfar	T	C	16: 13,687,444	I106T	possibly damaging	Het
Cbx8	T	C	11: 119,039,533		probably null	Het
Cd80	T	C	16: 38,473,883	S43P	probably damaging	Het
E330017A01Rik	A	T	16: 58,637,694	Y81*	probably null	Het
Fat4	G	A	3: 38,890,371	A1138T	probably benign	Het
Fmo3	C	A	1: 162,967,823	G148W	probably damaging	Het
Krt78	T	C	15: 101,951,810	M224V	probably benign	Het
Moxd2	A	G	6: 40,891,897		probably benign	Het
Olfr1384	T	A	11: 49,514,594	*319K	probably null	Het
Olfr215	A	G	6: 116,582,866	S27P	probably benign	Het
Olfr702	T	A	7: 106,824,197	T110S	possibly damaging	Het
Pax6	G	A	2: 105,685,913	G179R	probably benign	Het
Rbm12	G	A	2: 156,097,492	Q287*	probably null	Het
Rtel1	T	A	2: 181,351,335	H703Q	probably benign	Het
Spag17	A	G	3: 100,095,638	R1893G	probably benign	Het
Synpo	A	G	18: 60,602,453	V807A	possibly damaging	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R9242:Atrnl1	UTSW	19	57657228	missense	probably benign	0.07
R9265:Atrnl1	UTSW	19	57777927	missense	probably benign	0.11
R9272:Atrnl1	UTSW	19	57654988	missense	probably benign	0.00
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGTCGGCCTGACAGTGTAGAAATG -3'
(R):5'- CTTGCCAACCGCACAACTTAGTG -3'

Sequencing Primer
(F):5'- CCTGACAGTGTAGAAATGTGTAAG -3'
(R):5'- GACCTATTCCGTGTACAGAGGAC -3'

Posted On

2014-01-15