Incidental Mutation 'R1214:Olfr341'
ID99510
Institutional Source Beutler Lab
Gene Symbol Olfr341
Ensembl Gene ENSMUSG00000075387
Gene Nameolfactory receptor 341
SynonymsGA_x6K02T2NLDC-33174915-33173974, MOR136-2
MMRRC Submission 039283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1214 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36473721-36482468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36479969 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 54 (H54N)
Ref Sequence ENSEMBL: ENSMUSP00000150801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100154] [ENSMUST00000213300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100154
AA Change: H54N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097731
Gene: ENSMUSG00000075387
AA Change: H54N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4e-6 PFAM
Pfam:7tm_1 41 290 9.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213300
AA Change: H54N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Dcdc2c A T 12: 28,530,430 Y201* probably null Het
Dock9 C T 14: 121,586,316 V1395I probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Micall2 T C 5: 139,711,641 S652G probably damaging Het
Olfr1289 T C 2: 111,483,892 F154S probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Ptpre A T 7: 135,679,258 S643C probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Slfn5 A G 11: 82,960,091 M405V probably benign Het
Ttc29 A G 8: 78,325,582 Y364C probably damaging Het
Wasf3 G A 5: 146,470,288 V473M probably damaging Het
Zcchc6 A G 13: 59,805,326 V100A possibly damaging Het
Other mutations in Olfr341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Olfr341 APN 2 36479356 missense probably damaging 1.00
IGL01469:Olfr341 APN 2 36479824 missense probably benign 0.44
IGL02269:Olfr341 APN 2 36479567 missense possibly damaging 0.86
IGL02870:Olfr341 APN 2 36480031 missense probably benign
IGL03190:Olfr341 APN 2 36479722 missense probably damaging 1.00
R0988:Olfr341 UTSW 2 36479767 missense probably damaging 1.00
R1785:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R1786:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2130:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2131:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2132:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2133:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2568:Olfr341 UTSW 2 36479974 missense probably damaging 1.00
R4115:Olfr341 UTSW 2 36479785 missense probably damaging 1.00
R4384:Olfr341 UTSW 2 36479998 missense probably damaging 1.00
R4721:Olfr341 UTSW 2 36479824 missense probably benign 0.44
R5375:Olfr341 UTSW 2 36479297 missense probably damaging 0.98
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6084:Olfr341 UTSW 2 36479512 missense probably benign 0.01
R6340:Olfr341 UTSW 2 36480020 missense probably benign 0.31
R7238:Olfr341 UTSW 2 36479714 missense possibly damaging 0.54
R7532:Olfr341 UTSW 2 36480126 start codon destroyed probably null 0.27
R7830:Olfr341 UTSW 2 36479380 missense probably damaging 1.00
R7910:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
R7991:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTCGACAGGCTCAATAAGGCAG -3'
(R):5'- TTTCACTCACAGCAGAAGAGGAAGAAC -3'

Sequencing Primer
(F):5'- CACAGAGGTTCTGACTCATGATG -3'
(R):5'- CATGAGGAGAGATAATGAGAGCACTG -3'
Posted On2014-01-15