Incidental Mutation 'R1214:Olfr1289'
ID99512
Institutional Source Beutler Lab
Gene Symbol Olfr1289
Ensembl Gene ENSMUSG00000061195
Gene Nameolfactory receptor 1289
SynonymsGA_x6K02T2Q125-72534883-72535821, MOR245-6
MMRRC Submission 039283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1214 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111480819-111484615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111483892 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 154 (F154S)
Ref Sequence ENSEMBL: ENSMUSP00000147119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102551] [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]
Predicted Effect probably damaging
Transcript: ENSMUST00000102551
AA Change: F154S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099611
Gene: ENSMUSG00000108908
AA Change: F154S

DomainStartEndE-ValueType
Pfam:7tm_4 17 289 6e-45 PFAM
Pfam:7TM_GPCR_Srsx 20 288 1.4e-7 PFAM
Pfam:7tm_1 27 273 7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104889
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120021
AA Change: F182S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207494
AA Change: F154S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000214816
Predicted Effect probably benign
Transcript: ENSMUST00000217611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Dcdc2c A T 12: 28,530,430 Y201* probably null Het
Dock9 C T 14: 121,586,316 V1395I probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Micall2 T C 5: 139,711,641 S652G probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr341 G T 2: 36,479,969 H54N possibly damaging Het
Ptpre A T 7: 135,679,258 S643C probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Slfn5 A G 11: 82,960,091 M405V probably benign Het
Ttc29 A G 8: 78,325,582 Y364C probably damaging Het
Wasf3 G A 5: 146,470,288 V473M probably damaging Het
Zcchc6 A G 13: 59,805,326 V100A possibly damaging Het
Other mutations in Olfr1289
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr1289 APN 2 111484101 missense probably damaging 1.00
IGL01682:Olfr1289 APN 2 111483843 missense probably damaging 1.00
IGL02028:Olfr1289 APN 2 111483471 missense probably benign 0.01
IGL02731:Olfr1289 APN 2 111483528 missense probably benign 0.00
IGL03035:Olfr1289 APN 2 111483823 missense probably benign 0.04
R1471:Olfr1289 UTSW 2 111484006 missense probably damaging 1.00
R1714:Olfr1289 UTSW 2 111483663 missense probably damaging 1.00
R2088:Olfr1289 UTSW 2 111484278 missense probably damaging 1.00
R2136:Olfr1289 UTSW 2 111483616 missense probably damaging 1.00
R2141:Olfr1289 UTSW 2 111483630 missense probably benign 0.23
R3945:Olfr1289 UTSW 2 111483687 nonsense probably null
R4276:Olfr1289 UTSW 2 111483504 missense probably damaging 1.00
R4562:Olfr1289 UTSW 2 111483564 missense probably benign 0.00
R4896:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R4946:Olfr1289 UTSW 2 111483966 missense possibly damaging 0.93
R5004:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R5686:Olfr1289 UTSW 2 111484143 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6960:Olfr1289 UTSW 2 111483726 missense possibly damaging 0.70
R7293:Olfr1289 UTSW 2 111483354 splice site probably null
R7642:Olfr1289 UTSW 2 111483478 missense probably damaging 0.96
R8429:Olfr1289 UTSW 2 111483495 missense possibly damaging 0.55
R8447:Olfr1289 UTSW 2 111483756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCCTCTGTCACAGCTCCAAAG -3'
(R):5'- TAGATGACCTATCAGAAGGGCGGC -3'

Sequencing Primer
(F):5'- GCAAAGTCATCTCTGTTAAGGGC -3'
(R):5'- CACTGTTGGCAATGACCATG -3'
Posted On2014-01-15