Incidental Mutation 'R1214:Wasf3'
ID99519
Institutional Source Beutler Lab
Gene Symbol Wasf3
Ensembl Gene ENSMUSG00000029636
Gene NameWAS protein family, member 3
SynonymsWave3
MMRRC Submission 039283-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1214 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location146384985-146473615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146470288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 473 (V473M)
Ref Sequence ENSEMBL: ENSMUSP00000016143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016143]
Predicted Effect probably damaging
Transcript: ENSMUST00000016143
AA Change: V473M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016143
Gene: ENSMUSG00000029636
AA Change: V473M

DomainStartEndE-ValueType
PDB:3P8C|D 1 171 1e-86 PDB
low complexity region 172 184 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 395 422 N/A INTRINSIC
WH2 439 456 4.97e-5 SMART
low complexity region 484 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. A pseudogene of this gene have been defined on chromosome 6. Alternative splicing results in multiple transcript variants [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Dcdc2c A T 12: 28,530,430 Y201* probably null Het
Dock9 C T 14: 121,586,316 V1395I probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Micall2 T C 5: 139,711,641 S652G probably damaging Het
Olfr1289 T C 2: 111,483,892 F154S probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr341 G T 2: 36,479,969 H54N possibly damaging Het
Ptpre A T 7: 135,679,258 S643C probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Slfn5 A G 11: 82,960,091 M405V probably benign Het
Ttc29 A G 8: 78,325,582 Y364C probably damaging Het
Zcchc6 A G 13: 59,805,326 V100A possibly damaging Het
Other mutations in Wasf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wasf3 APN 5 146455651 missense probably damaging 1.00
IGL01992:Wasf3 APN 5 146455591 missense probably damaging 1.00
IGL02866:Wasf3 APN 5 146468321 missense probably benign 0.28
FR4737:Wasf3 UTSW 5 146470250 missense probably damaging 0.99
R0622:Wasf3 UTSW 5 146466792 splice site probably null
R1083:Wasf3 UTSW 5 146435372 missense probably damaging 1.00
R1259:Wasf3 UTSW 5 146451976 missense probably damaging 1.00
R1355:Wasf3 UTSW 5 146470208 splice site probably benign
R1370:Wasf3 UTSW 5 146470208 splice site probably benign
R1727:Wasf3 UTSW 5 146466959 missense probably benign
R4837:Wasf3 UTSW 5 146460978 missense probably benign 0.16
R5080:Wasf3 UTSW 5 146461097 missense probably benign
R6046:Wasf3 UTSW 5 146470356 missense unknown
R6386:Wasf3 UTSW 5 146453417 missense possibly damaging 0.77
R7181:Wasf3 UTSW 5 146466805 missense probably benign
R7229:Wasf3 UTSW 5 146455653 missense probably damaging 1.00
R8438:Wasf3 UTSW 5 146453427 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCGGCCTGTTGTGTTACCAAG -3'
(R):5'- CTGAGAGGGAAGCAAGATGCTGTTC -3'

Sequencing Primer
(F):5'- TGTTACCAAGCAGTAGCACAG -3'
(R):5'- GTTCCAGGGTGATGCACTAATAC -3'
Posted On2014-01-15