Mutagenetix > Incidental Mutations

Incidental Mutation 'R1214:Ptpre'

99523

Institutional Source

Beutler Lab

Gene Symbol

Ptpre

Ensembl Gene

ENSMUSG00000041836

Gene Name

protein tyrosine phosphatase, receptor type, E

Synonyms

PTPe, RPTPepsilon, PTPepsilon

MMRRC Submission

039283-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.794) question?

Stock #

R1214 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

135537481-135686293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135679258 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 643 (S643C)

Ref Sequence

ENSEMBL: ENSMUSP00000147524 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073961
AA Change: S630C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836
AA Change: S630C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
transmembrane domain	48	70	N/A	INTRINSIC
PTPc	133	395	4.65e-136	SMART
PTPc	424	690	7.36e-116	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000209256
AA Change: S650C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000209979
AA Change: S573C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000210833
AA Change: S630C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211140
AA Change: S630C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211788
AA Change: S643C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Dcdc2c	A	T	12: 28,530,430	Y201*	probably null	Het
Dock9	C	T	14: 121,586,316	V1395I	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Micall2	T	C	5: 139,711,641	S652G	probably damaging	Het
Olfr1289	T	C	2: 111,483,892	F154S	probably damaging	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr341	G	T	2: 36,479,969	H54N	possibly damaging	Het
Slc26a5	T	A	5: 21,814,983	I530F	probably damaging	Het
Slfn5	A	G	11: 82,960,091	M405V	probably benign	Het
Ttc29	A	G	8: 78,325,582	Y364C	probably damaging	Het
Wasf3	G	A	5: 146,470,288	V473M	probably damaging	Het
Zcchc6	A	G	13: 59,805,326	V100A	possibly damaging	Het

Other mutations in Ptpre

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00918:Ptpre	APN	7	135659053	missense	probably damaging	0.98
IGL01019:Ptpre	APN	7	135678325	nonsense	probably null
IGL01115:Ptpre	APN	7	135670764	missense	probably damaging	1.00
IGL01456:Ptpre	APN	7	135669802	missense	probably damaging	1.00
IGL01516:Ptpre	APN	7	135664999	missense	probably damaging	0.97
IGL02108:Ptpre	APN	7	135659102	missense	possibly damaging	0.85
IGL02735:Ptpre	APN	7	135667567	missense	probably damaging	1.00
IGL03326:Ptpre	APN	7	135672817	missense	probably damaging	1.00
IGL03327:Ptpre	APN	7	135672822	critical splice donor site	probably null
R0183:Ptpre	UTSW	7	135669845	missense	probably benign	0.01
R0369:Ptpre	UTSW	7	135670715	missense	probably damaging	1.00
R0538:Ptpre	UTSW	7	135663315	missense	probably damaging	0.99
R0762:Ptpre	UTSW	7	135679235	missense	probably damaging	0.99
R1169:Ptpre	UTSW	7	135667612	missense	probably benign	0.33
R1629:Ptpre	UTSW	7	135669799	missense	probably damaging	1.00
R1654:Ptpre	UTSW	7	135653928	missense	probably benign	0.32
R1819:Ptpre	UTSW	7	135668993	splice site	probably benign
R1876:Ptpre	UTSW	7	135678317	missense	possibly damaging	0.73
R2049:Ptpre	UTSW	7	135670695	splice site	probably benign
R2284:Ptpre	UTSW	7	135669781	missense	probably benign	0.05
R2895:Ptpre	UTSW	7	135643858	nonsense	probably null
R4508:Ptpre	UTSW	7	135669103	missense	probably damaging	1.00
R4603:Ptpre	UTSW	7	135667643	nonsense	probably null
R4644:Ptpre	UTSW	7	135651932	intron	probably benign
R4863:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R4989:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5015:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5133:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5134:Ptpre	UTSW	7	135652092	missense	probably damaging	0.96
R5291:Ptpre	UTSW	7	135678301	missense	probably benign
R5372:Ptpre	UTSW	7	135653940	missense	possibly damaging	0.87
R5653:Ptpre	UTSW	7	135653943	missense	probably damaging	0.99
R5896:Ptpre	UTSW	7	135674278	missense	probably benign	0.39
R6238:Ptpre	UTSW	7	135671180	missense	probably damaging	1.00
R6974:Ptpre	UTSW	7	135669148	missense	possibly damaging	0.95
R7125:Ptpre	UTSW	7	135654015	nonsense	probably null
R7298:Ptpre	UTSW	7	135683287	missense	probably damaging	1.00
R7453:Ptpre	UTSW	7	135538074	missense	unknown
R7459:Ptpre	UTSW	7	135667600	missense	probably benign
R7855:Ptpre	UTSW	7	135651995	missense	probably benign
R7970:Ptpre	UTSW	7	135678319	missense	possibly damaging	0.51
R8003:Ptpre	UTSW	7	135669036	missense	probably damaging	0.96
R8768:Ptpre	UTSW	7	135681577	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ATGGGCAAGGCAAGCAGATTCC -3'
(R):5'- ACAGTGAACACAGCTAAGCCGATG -3'

Sequencing Primer
(F):5'- GCAGATTCCTGGCAGGATG -3'
(R):5'- TGTGCCCATCtgtgtgtg -3'

Posted On

2014-01-15