Incidental Mutation 'R1214:Ttc29'
ID99525
Institutional Source Beutler Lab
Gene Symbol Ttc29
Ensembl Gene ENSMUSG00000037101
Gene Nametetratricopeptide repeat domain 29
Synonyms1700031F13Rik
MMRRC Submission 039283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1214 (G1)
Quality Score121
Status Not validated
Chromosome8
Chromosomal Location78213297-78394326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78325582 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 364 (Y364C)
Ref Sequence ENSEMBL: ENSMUSP00000105528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049395] [ENSMUST00000109902]
Predicted Effect probably damaging
Transcript: ENSMUST00000049395
AA Change: Y364C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041919
Gene: ENSMUSG00000037101
AA Change: Y364C

DomainStartEndE-ValueType
low complexity region 189 199 N/A INTRINSIC
Blast:TPR 234 267 2e-7 BLAST
TPR 274 307 4.1e1 SMART
TPR 314 347 2.48e0 SMART
TPR 354 387 2.48e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109902
AA Change: Y364C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105528
Gene: ENSMUSG00000037101
AA Change: Y364C

DomainStartEndE-ValueType
low complexity region 189 199 N/A INTRINSIC
Blast:TPR 234 267 2e-7 BLAST
TPR 274 307 4.1e1 SMART
TPR 314 347 2.48e0 SMART
TPR 354 387 2.48e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Dcdc2c A T 12: 28,530,430 Y201* probably null Het
Dock9 C T 14: 121,586,316 V1395I probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Micall2 T C 5: 139,711,641 S652G probably damaging Het
Olfr1289 T C 2: 111,483,892 F154S probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr341 G T 2: 36,479,969 H54N possibly damaging Het
Ptpre A T 7: 135,679,258 S643C probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Slfn5 A G 11: 82,960,091 M405V probably benign Het
Wasf3 G A 5: 146,470,288 V473M probably damaging Het
Zcchc6 A G 13: 59,805,326 V100A possibly damaging Het
Other mutations in Ttc29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Ttc29 APN 8 78333756 missense probably benign 0.13
IGL01785:Ttc29 APN 8 78282341 missense probably damaging 1.00
IGL02412:Ttc29 APN 8 78276940 missense possibly damaging 0.47
IGL03068:Ttc29 APN 8 78325551 missense probably benign 0.00
PIT4519001:Ttc29 UTSW 8 78325477 missense probably benign 0.04
R0523:Ttc29 UTSW 8 78276837 missense probably benign 0.01
R1869:Ttc29 UTSW 8 78282385 missense probably benign
R1902:Ttc29 UTSW 8 78251732 missense probably benign 0.03
R1903:Ttc29 UTSW 8 78251732 missense probably benign 0.03
R4612:Ttc29 UTSW 8 78325546 missense probably benign 0.02
R4649:Ttc29 UTSW 8 78333579 missense probably benign 0.12
R4892:Ttc29 UTSW 8 78333645 missense probably damaging 0.98
R5306:Ttc29 UTSW 8 78251910 critical splice donor site probably null
R5649:Ttc29 UTSW 8 78246313 missense possibly damaging 0.47
R5996:Ttc29 UTSW 8 78276896 missense probably damaging 0.99
R6036:Ttc29 UTSW 8 78325576 missense probably benign 0.03
R6036:Ttc29 UTSW 8 78325576 missense probably benign 0.03
R6495:Ttc29 UTSW 8 78282334 missense possibly damaging 0.79
R6813:Ttc29 UTSW 8 78333620 missense probably benign 0.01
R6961:Ttc29 UTSW 8 78276916 missense possibly damaging 0.77
R7686:Ttc29 UTSW 8 78393130 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGCTTTAGCTCATTGCATACCCCAC -3'
(R):5'- TCAGAGCAAGCTGATAAGAGCCAAC -3'

Sequencing Primer
(F):5'- AGCTTATGCCAGGTCTAACG -3'
(R):5'- CCTCACAGTCAGTTACTGAATGG -3'
Posted On2014-01-15