Incidental Mutation 'R1214:Slfn5'
ID99531
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Nameschlafen 5
Synonyms
MMRRC Submission 039283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1214 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82951349-82964840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82960091 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 405 (M405V)
Ref Sequence ENSEMBL: ENSMUSP00000103792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
Predicted Effect probably benign
Transcript: ENSMUST00000067443
AA Change: M405V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404
AA Change: M405V

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108157
AA Change: M405V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404
AA Change: M405V

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108158
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216469
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Dcdc2c A T 12: 28,530,430 Y201* probably null Het
Dock9 C T 14: 121,586,316 V1395I probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Micall2 T C 5: 139,711,641 S652G probably damaging Het
Olfr1289 T C 2: 111,483,892 F154S probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr341 G T 2: 36,479,969 H54N possibly damaging Het
Ptpre A T 7: 135,679,258 S643C probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Ttc29 A G 8: 78,325,582 Y364C probably damaging Het
Wasf3 G A 5: 146,470,288 V473M probably damaging Het
Zcchc6 A G 13: 59,805,326 V100A possibly damaging Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1005:Slfn5 UTSW 11 82960158 missense probably damaging 1.00
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5113:Slfn5 UTSW 11 82961696 missense probably benign 0.01
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5498:Slfn5 UTSW 11 82957147 missense possibly damaging 0.84
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6543:Slfn5 UTSW 11 82958666 splice site probably null
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7309:Slfn5 UTSW 11 82956703 missense probably damaging 1.00
R7478:Slfn5 UTSW 11 82960616 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
R8264:Slfn5 UTSW 11 82956550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCCTCAGACTCAAGATTGCTTC -3'
(R):5'- CCCACTTGTTGCAAATGGTGTACAG -3'

Sequencing Primer
(F):5'- ccctctaaatcctgctgcc -3'
(R):5'- ACAGGATTGGAACGTTGTTCG -3'
Posted On2014-01-15