Incidental Mutation 'R1214:Dcdc2c'
ID99533
Institutional Source Beutler Lab
Gene Symbol Dcdc2c
Ensembl Gene ENSMUSG00000020633
Gene Namedoublecortin domain containing 2C
Synonyms1110015M06Rik
MMRRC Submission 039283-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1214 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location28437795-28552399 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28530430 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 201 (Y201*)
Ref Sequence ENSEMBL: ENSMUSP00000152233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020963] [ENSMUST00000189735] [ENSMUST00000221349]
Predicted Effect probably null
Transcript: ENSMUST00000020963
AA Change: Y201*
SMART Domains Protein: ENSMUSP00000020963
Gene: ENSMUSG00000020633
AA Change: Y201*

DomainStartEndE-ValueType
DCX 11 98 2.16e-29 SMART
DCX 131 217 6.18e-7 SMART
low complexity region 302 316 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185916
AA Change: Y133*
Predicted Effect probably null
Transcript: ENSMUST00000189735
AA Change: Y33*
SMART Domains Protein: ENSMUSP00000140603
Gene: ENSMUSG00000020633
AA Change: Y33*

DomainStartEndE-ValueType
Pfam:DCX 1 44 1.5e-9 PFAM
low complexity region 134 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000221349
AA Change: Y201*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Dock9 C T 14: 121,586,316 V1395I probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Micall2 T C 5: 139,711,641 S652G probably damaging Het
Olfr1289 T C 2: 111,483,892 F154S probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr341 G T 2: 36,479,969 H54N possibly damaging Het
Ptpre A T 7: 135,679,258 S643C probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Slfn5 A G 11: 82,960,091 M405V probably benign Het
Ttc29 A G 8: 78,325,582 Y364C probably damaging Het
Wasf3 G A 5: 146,470,288 V473M probably damaging Het
Zcchc6 A G 13: 59,805,326 V100A possibly damaging Het
Other mutations in Dcdc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Dcdc2c APN 12 28535545 missense probably benign 0.03
R3040:Dcdc2c UTSW 12 28552182 missense probably damaging 1.00
R4937:Dcdc2c UTSW 12 28530473 missense possibly damaging 0.69
R5268:Dcdc2c UTSW 12 28516657 missense possibly damaging 0.83
R5920:Dcdc2c UTSW 12 28535537 missense possibly damaging 0.67
R5921:Dcdc2c UTSW 12 28524775 missense possibly damaging 0.90
R6444:Dcdc2c UTSW 12 28535476 missense probably damaging 1.00
R6939:Dcdc2c UTSW 12 28541497 missense probably benign 0.09
R7044:Dcdc2c UTSW 12 28470494 utr 3 prime probably benign
R7235:Dcdc2c UTSW 12 28470719 missense
R7287:Dcdc2c UTSW 12 28516686 missense probably benign
R7767:Dcdc2c UTSW 12 28470257 missense
R7896:Dcdc2c UTSW 12 28470620 nonsense probably null
R7964:Dcdc2c UTSW 12 28470319 missense
Z1176:Dcdc2c UTSW 12 28524707 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCAAAATGGTCACTCAGACCAGAG -3'
(R):5'- TGTGCAGTCCAGGAAGAACAGCTC -3'

Sequencing Primer
(F):5'- agagacagagacagagagacag -3'
(R):5'- AGCTCCCAAAGGCTTCCTG -3'
Posted On2014-01-15