Incidental Mutation 'R1172:Lrrc19'
ID99536
Institutional Source Beutler Lab
Gene Symbol Lrrc19
Ensembl Gene ENSMUSG00000049799
Gene Nameleucine rich repeat containing 19
Synonyms
MMRRC Submission 039245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1172 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location94636653-94650144 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 94638389 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 310 (Y310*)
Ref Sequence ENSEMBL: ENSMUSP00000102718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000053419] [ENSMUST00000107101] [ENSMUST00000107104]
Predicted Effect probably benign
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053419
AA Change: Y310*
SMART Domains Protein: ENSMUSP00000056094
Gene: ENSMUSG00000049799
AA Change: Y310*

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 250 364 8.1e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107101
AA Change: Y310*
SMART Domains Protein: ENSMUSP00000102718
Gene: ENSMUSG00000049799
AA Change: Y310*

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 245 364 9.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Meta Mutation Damage Score 0.9662 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C A 4: 35,218,630 E76D probably damaging Het
Accsl A T 2: 93,866,244 probably benign Het
Adam7 T G 14: 68,514,921 K371N probably damaging Het
Adgrv1 A T 13: 81,557,063 S1543T probably damaging Het
Agbl4 A T 4: 111,656,318 probably benign Het
Arid1b T A 17: 5,339,300 I1707N probably damaging Het
Atp10a T C 7: 58,803,766 V864A probably benign Het
Bivm A G 1: 44,126,782 T131A probably benign Het
Bst1 A G 5: 43,825,408 probably null Het
Cblb T C 16: 52,186,240 probably benign Het
Ccdc28b T C 4: 129,620,889 probably benign Het
Cmas G T 6: 142,756,878 G36C probably benign Het
Eml6 A G 11: 29,749,824 S1771P possibly damaging Het
Epc1 A C 18: 6,490,525 Y31D probably damaging Het
Fbn1 A T 2: 125,394,687 C358S probably benign Het
Fbxl13 A T 5: 21,620,604 probably benign Het
Fermt2 T C 14: 45,459,968 D642G possibly damaging Het
Fmnl2 A T 2: 53,072,274 N257I probably damaging Het
Fry G A 5: 150,481,494 W793* probably null Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Glipr1l2 C A 10: 112,083,466 L31I possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21718 T C 14: 51,315,891 noncoding transcript Het
Gpld1 A G 13: 24,957,566 probably null Het
Gtf3c2 A T 5: 31,168,075 Y500N probably damaging Het
Hbs1l A G 10: 21,304,638 D73G probably damaging Het
Idh1 G T 1: 65,161,160 N348K probably benign Het
Kank4 T C 4: 98,765,569 Y874C probably damaging Het
Lamc2 A T 1: 153,166,287 S34T probably damaging Het
Laptm4a T C 12: 8,936,716 V258A probably damaging Het
Map3k5 G A 10: 20,056,648 probably benign Het
Map7 G A 10: 20,245,299 E92K probably damaging Het
Mettl24 G A 10: 40,737,708 A148T probably benign Het
Mosmo A G 7: 120,730,522 Y122C probably benign Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 T C 14: 69,191,985 S151P probably damaging Het
Npm2 T A 14: 70,652,221 K54* probably null Het
Npr1 T A 3: 90,461,382 D457V probably benign Het
Nudt21 T C 8: 94,031,129 probably benign Het
Pcnt A T 10: 76,393,044 probably null Het
Pik3r4 G T 9: 105,663,174 G754C probably damaging Het
Rftn2 A G 1: 55,211,217 V123A probably damaging Het
Rpa1 A T 11: 75,312,393 V392D probably damaging Het
Rxfp2 T C 5: 150,051,556 V210A probably benign Het
Slc45a4 C T 15: 73,605,429 probably benign Het
Syndig1l T A 12: 84,679,168 probably null Het
Tctn1 G A 5: 122,251,689 R257* probably null Het
Tenm4 A T 7: 96,848,044 E1179V probably damaging Het
Txlnb A G 10: 17,842,756 N445S probably benign Het
Tyrp1 C T 4: 80,844,868 Q331* probably null Het
Ubap2l A T 3: 90,023,500 S413T probably benign Het
Vdr A T 15: 97,869,333 Y185N probably benign Het
Vmn2r66 G T 7: 85,005,591 D503E probably benign Het
Vmn2r72 T A 7: 85,751,944 E89V probably damaging Het
Vmn2r87 T C 10: 130,477,584 T438A probably benign Het
Xrcc6 A G 15: 82,031,163 D94G probably damaging Het
Ywhaq T C 12: 21,395,023 N207S probably benign Het
Zfp185 A T X: 72,999,323 E138D possibly damaging Het
Zfp981 G A 4: 146,537,764 S382N probably benign Het
Other mutations in Lrrc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Lrrc19 APN 4 94638508 missense probably damaging 0.99
IGL02585:Lrrc19 APN 4 94643325 missense probably benign 0.00
R0087:Lrrc19 UTSW 4 94640772 missense probably damaging 1.00
R0629:Lrrc19 UTSW 4 94638252 missense probably damaging 1.00
R1572:Lrrc19 UTSW 4 94638429 missense probably damaging 1.00
R1576:Lrrc19 UTSW 4 94639353 missense probably damaging 1.00
R1589:Lrrc19 UTSW 4 94640950 missense probably benign 0.24
R2107:Lrrc19 UTSW 4 94639294 missense probably benign
R4734:Lrrc19 UTSW 4 94638349 missense probably benign 0.01
R4932:Lrrc19 UTSW 4 94640937 missense probably damaging 1.00
R6079:Lrrc19 UTSW 4 94643343 missense probably benign 0.17
R6969:Lrrc19 UTSW 4 94639373 missense probably benign 0.44
R7293:Lrrc19 UTSW 4 94638390 missense probably benign 0.07
R7596:Lrrc19 UTSW 4 94643355 missense probably benign
Predicted Primers
Posted On2014-01-15