Incidental Mutation 'R1214:Or2ad1'
ID 99537
Institutional Source Beutler Lab
Gene Symbol Or2ad1
Ensembl Gene ENSMUSG00000045474
Gene Name olfactory receptor family 2 subfamily AD member 1
Synonyms MOR256-15, Olfr1368, GA_x6K02T2QHY8-12104556-12105500
MMRRC Submission 039283-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R1214 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 21326281-21327225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21326337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 297 (V297I)
Ref Sequence ENSEMBL: ENSMUSP00000149549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055298] [ENSMUST00000216039]
AlphaFold Q8VFG3
Predicted Effect probably benign
Transcript: ENSMUST00000055298
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050942
Gene: ENSMUSG00000045474
AA Change: V297I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.8e-49 PFAM
Pfam:7tm_1 41 290 1.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206267
Predicted Effect probably benign
Transcript: ENSMUST00000216039
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Dcdc2c A T 12: 28,580,429 (GRCm39) Y201* probably null Het
Dock9 C T 14: 121,823,728 (GRCm39) V1395I probably benign Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Micall2 T C 5: 139,697,396 (GRCm39) S652G probably damaging Het
Or1j13 G T 2: 36,369,981 (GRCm39) H54N possibly damaging Het
Or4f4b T C 2: 111,314,237 (GRCm39) F154S probably damaging Het
Ptpre A T 7: 135,280,987 (GRCm39) S643C probably damaging Het
Slc26a5 T A 5: 22,019,981 (GRCm39) I530F probably damaging Het
Slfn5 A G 11: 82,850,917 (GRCm39) M405V probably benign Het
Ttc29 A G 8: 79,052,211 (GRCm39) Y364C probably damaging Het
Tut7 A G 13: 59,953,140 (GRCm39) V100A possibly damaging Het
Wasf3 G A 5: 146,407,098 (GRCm39) V473M probably damaging Het
Other mutations in Or2ad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03354:Or2ad1 APN 13 21,326,654 (GRCm39) missense probably damaging 1.00
IGL03385:Or2ad1 APN 13 21,326,657 (GRCm39) missense probably benign 0.01
R0137:Or2ad1 UTSW 13 21,326,336 (GRCm39) missense possibly damaging 0.86
R1168:Or2ad1 UTSW 13 21,326,787 (GRCm39) missense probably benign 0.04
R1212:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1237:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1238:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1239:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1280:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1309:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1436:Or2ad1 UTSW 13 21,327,162 (GRCm39) missense probably benign 0.01
R1443:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1444:Or2ad1 UTSW 13 21,326,337 (GRCm39) missense probably benign 0.16
R1602:Or2ad1 UTSW 13 21,326,820 (GRCm39) missense probably damaging 0.99
R1627:Or2ad1 UTSW 13 21,327,125 (GRCm39) missense probably damaging 0.99
R1649:Or2ad1 UTSW 13 21,326,912 (GRCm39) missense probably damaging 1.00
R1781:Or2ad1 UTSW 13 21,326,934 (GRCm39) missense probably benign 0.08
R1858:Or2ad1 UTSW 13 21,326,564 (GRCm39) missense probably damaging 1.00
R2520:Or2ad1 UTSW 13 21,326,746 (GRCm39) nonsense probably null
R4873:Or2ad1 UTSW 13 21,326,450 (GRCm39) missense probably damaging 1.00
R4875:Or2ad1 UTSW 13 21,326,450 (GRCm39) missense probably damaging 1.00
R5009:Or2ad1 UTSW 13 21,326,435 (GRCm39) missense probably benign 0.01
R6222:Or2ad1 UTSW 13 21,327,047 (GRCm39) missense probably damaging 1.00
R7031:Or2ad1 UTSW 13 21,327,170 (GRCm39) missense probably benign
R7126:Or2ad1 UTSW 13 21,326,888 (GRCm39) missense probably damaging 1.00
R7691:Or2ad1 UTSW 13 21,327,140 (GRCm39) missense probably benign
R7875:Or2ad1 UTSW 13 21,327,093 (GRCm39) missense probably damaging 1.00
R7966:Or2ad1 UTSW 13 21,326,356 (GRCm39) nonsense probably null
R8015:Or2ad1 UTSW 13 21,326,303 (GRCm39) missense probably benign
R8155:Or2ad1 UTSW 13 21,327,062 (GRCm39) missense probably damaging 1.00
R8247:Or2ad1 UTSW 13 21,326,295 (GRCm39) missense probably benign
R8787:Or2ad1 UTSW 13 21,326,453 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCAGGGAAATGGTCCTGAATGAAC -3'
(R):5'- ACCCTGTGCTTTGCCAGAAGATG -3'

Sequencing Primer
(F):5'- CTGATCTGCCACTATGACAAGGG -3'
(R):5'- GCAGTTATCACTCAAGCTGTG -3'
Posted On 2014-01-15