Mutagenetix > Incidental Mutations

Incidental Mutation 'R1214:Zcchc6'

99539

Institutional Source

Beutler Lab

Gene Symbol

Zcchc6

Ensembl Gene

ENSMUSG00000035248

Gene Name

zinc finger, CCHC domain containing 6

Synonyms

6030448M23Rik

MMRRC Submission

039283-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.746) question?

Stock #

R1214 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59771561-59823147 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59805326 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 100 (V100A)

Ref Sequence

ENSEMBL: ENSMUSP00000153376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071703] [ENSMUST00000224480]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071703
AA Change: V502A

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000071623
Gene: ENSMUSG00000035248
AA Change: V502A

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
low complexity region	176	190	N/A	INTRINSIC
ZnF_C2H2	244	268	2.61e1	SMART
SCOP:d1f5aa2	284	497	4e-25	SMART
low complexity region	522	534	N/A	INTRINSIC
Pfam:PAP_assoc	550	603	6.7e-14	PFAM
low complexity region	811	825	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	882	898	N/A	INTRINSIC
ZnF_C2HC	960	976	3.3e-3	SMART
Pfam:NTP_transf_2	1022	1134	4e-8	PFAM
Pfam:PAP_assoc	1229	1282	1.7e-17	PFAM
ZnF_C2HC	1342	1358	2.09e-3	SMART
Pfam:TUTF7_u4	1359	1446	1.6e-42	PFAM
ZnF_C2HC	1448	1464	1.06e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224480
AA Change: V100A

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

unknown
Transcript: ENSMUST00000225241
AA Change: V90A

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Dcdc2c	A	T	12: 28,530,430	Y201*	probably null	Het
Dock9	C	T	14: 121,586,316	V1395I	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Micall2	T	C	5: 139,711,641	S652G	probably damaging	Het
Olfr1289	T	C	2: 111,483,892	F154S	probably damaging	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr341	G	T	2: 36,479,969	H54N	possibly damaging	Het
Ptpre	A	T	7: 135,679,258	S643C	probably damaging	Het
Slc26a5	T	A	5: 21,814,983	I530F	probably damaging	Het
Slfn5	A	G	11: 82,960,091	M405V	probably benign	Het
Ttc29	A	G	8: 78,325,582	Y364C	probably damaging	Het
Wasf3	G	A	5: 146,470,288	V473M	probably damaging	Het

Other mutations in Zcchc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Zcchc6	APN	13	59816698	missense	probably damaging	1.00
IGL01361:Zcchc6	APN	13	59785800	missense	probably damaging	1.00
IGL02002:Zcchc6	APN	13	59782096	missense	possibly damaging	0.76
IGL02015:Zcchc6	APN	13	59789258	missense	probably damaging	1.00
IGL02029:Zcchc6	APN	13	59784888	unclassified	probably benign
IGL02216:Zcchc6	APN	13	59800423	missense	probably benign	0.01
IGL02705:Zcchc6	APN	13	59789203	missense	probably damaging	1.00
IGL02742:Zcchc6	APN	13	59816342	missense	probably damaging	0.99
IGL02810:Zcchc6	APN	13	59782016	critical splice donor site	probably null
IGL02942:Zcchc6	APN	13	59811521	missense	probably damaging	0.98
IGL03104:Zcchc6	APN	13	59814903	missense	probably benign	0.04
R0025:Zcchc6	UTSW	13	59805328	missense	probably benign	0.08
R0025:Zcchc6	UTSW	13	59805328	missense	probably benign	0.08
R0153:Zcchc6	UTSW	13	59782336	nonsense	probably null
R0269:Zcchc6	UTSW	13	59816855	splice site	probably null
R0358:Zcchc6	UTSW	13	59782104	missense	probably damaging	0.99
R0555:Zcchc6	UTSW	13	59800317	missense	probably benign	0.00
R0599:Zcchc6	UTSW	13	59809487	missense	probably damaging	1.00
R0609:Zcchc6	UTSW	13	59799782	nonsense	probably null
R0617:Zcchc6	UTSW	13	59816855	splice site	probably null
R0680:Zcchc6	UTSW	13	59800599	missense	possibly damaging	0.79
R0699:Zcchc6	UTSW	13	59782014	splice site	probably benign
R1271:Zcchc6	UTSW	13	59821855	missense	probably damaging	0.99
R1556:Zcchc6	UTSW	13	59800240	missense	probably benign	0.02
R1662:Zcchc6	UTSW	13	59799903	missense	possibly damaging	0.93
R1777:Zcchc6	UTSW	13	59791821	missense	probably damaging	1.00
R1834:Zcchc6	UTSW	13	59814935	nonsense	probably null
R1928:Zcchc6	UTSW	13	59816734	missense	probably damaging	1.00
R2012:Zcchc6	UTSW	13	59811538	missense	probably damaging	0.99
R2045:Zcchc6	UTSW	13	59800656	missense	probably damaging	1.00
R2336:Zcchc6	UTSW	13	59799054	missense	probably damaging	1.00
R3764:Zcchc6	UTSW	13	59800380	missense	probably damaging	0.98
R3899:Zcchc6	UTSW	13	59789255	nonsense	probably null
R3918:Zcchc6	UTSW	13	59782024	missense	probably damaging	1.00
R4423:Zcchc6	UTSW	13	59822049	missense	probably damaging	0.96
R4664:Zcchc6	UTSW	13	59800599	missense	possibly damaging	0.79
R4673:Zcchc6	UTSW	13	59796845	missense	probably damaging	1.00
R4770:Zcchc6	UTSW	13	59772884	unclassified	probably benign
R4884:Zcchc6	UTSW	13	59789452	missense	probably damaging	1.00
R5186:Zcchc6	UTSW	13	59816656	critical splice donor site	probably null
R5337:Zcchc6	UTSW	13	59791852	missense	probably damaging	1.00
R5385:Zcchc6	UTSW	13	59789846	critical splice donor site	probably null
R5452:Zcchc6	UTSW	13	59800657	missense	probably damaging	1.00
R5534:Zcchc6	UTSW	13	59788553	missense	probably damaging	1.00
R5566:Zcchc6	UTSW	13	59788629	nonsense	probably null
R5928:Zcchc6	UTSW	13	59822066	missense	probably benign	0.16
R5994:Zcchc6	UTSW	13	59789209	missense	probably damaging	1.00
R6415:Zcchc6	UTSW	13	59816296	splice site	probably null
R6495:Zcchc6	UTSW	13	59799939	missense	possibly damaging	0.95
R6577:Zcchc6	UTSW	13	59808161	missense	probably damaging	1.00
R7205:Zcchc6	UTSW	13	59788550	missense	probably damaging	1.00
R7286:Zcchc6	UTSW	13	59821649	missense	probably benign	0.18
R7355:Zcchc6	UTSW	13	59821802	missense	probably benign	0.00
R7369:Zcchc6	UTSW	13	59782053	missense	possibly damaging	0.71
R7455:Zcchc6	UTSW	13	59822057	missense	probably benign	0.03
R7557:Zcchc6	UTSW	13	59788466	missense	possibly damaging	0.89
R7635:Zcchc6	UTSW	13	59800090	missense	probably benign	0.03
R7727:Zcchc6	UTSW	13	59799682	missense	probably benign	0.00
R7798:Zcchc6	UTSW	13	59815575	missense	possibly damaging	0.81
R7912:Zcchc6	UTSW	13	59799005	missense	probably damaging	1.00
R7915:Zcchc6	UTSW	13	59784814	missense	probably benign	0.12
R8035:Zcchc6	UTSW	13	59789190	missense	probably benign	0.00
R8531:Zcchc6	UTSW	13	59789260	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCCGATGGGAAGGTCAGTGTATG -3'
(R):5'- TCAGACAGCAAGTGCTCTTGCC -3'

Sequencing Primer
(F):5'- TCAGTGTATGACCAGAGAGGAAC -3'
(R):5'- aaatctgtctgcctctgcc -3'

Posted On

2014-01-15