Incidental Mutation 'R1214:Dock9'
ID 99543
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 039283-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1214 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121823728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1395 (V1395I)
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: V1404I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: V1404I

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: V1375I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: V1375I

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211907
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: V1405I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212283
AA Change: V1207I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212371
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: V1395I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212719
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Dcdc2c A T 12: 28,580,429 (GRCm39) Y201* probably null Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Micall2 T C 5: 139,697,396 (GRCm39) S652G probably damaging Het
Or1j13 G T 2: 36,369,981 (GRCm39) H54N possibly damaging Het
Or2ad1 C T 13: 21,326,337 (GRCm39) V297I probably benign Het
Or4f4b T C 2: 111,314,237 (GRCm39) F154S probably damaging Het
Ptpre A T 7: 135,280,987 (GRCm39) S643C probably damaging Het
Slc26a5 T A 5: 22,019,981 (GRCm39) I530F probably damaging Het
Slfn5 A G 11: 82,850,917 (GRCm39) M405V probably benign Het
Ttc29 A G 8: 79,052,211 (GRCm39) Y364C probably damaging Het
Tut7 A G 13: 59,953,140 (GRCm39) V100A possibly damaging Het
Wasf3 G A 5: 146,407,098 (GRCm39) V473M probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGGAATGCTGCATTAAGGGAACC -3'
(R):5'- AGCTGAAACAGATGCTCCATGAATGAC -3'

Sequencing Primer
(F):5'- CTGCATTAAGGGAACCTTAAGAC -3'
(R):5'- TTATTAATGCCACCTCCCTACAGAG -3'
Posted On 2014-01-15