Incidental Mutation 'R1215:Cntfr'
ID 99558
Institutional Source Beutler Lab
Gene Symbol Cntfr
Ensembl Gene ENSMUSG00000028444
Gene Name ciliary neurotrophic factor receptor
Synonyms Cntfralpha
MMRRC Submission 039284-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1215 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 41657498-41697089 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 41662064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 226 (W226L)
Ref Sequence ENSEMBL: ENSMUSP00000100027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102961] [ENSMUST00000102962]
AlphaFold O88507
Predicted Effect probably damaging
Transcript: ENSMUST00000102961
AA Change: W226L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100026
Gene: ENSMUSG00000028444
AA Change: W226L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102962
AA Change: W226L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100027
Gene: ENSMUSG00000028444
AA Change: W226L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151181
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the ciliary neurotrophic factor (CNTF) receptor that triggers the assembly of a trimolecular complex upon binding to CNTF, and initiate a downstream signaling process. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-linked cell surface protein. Mice lacking the encoded protein die shortly after birth and exhibit a reduction of motoneuron number at birth. The transgenic disruption of this gene specifically in the skeletal muscle followed by a peripheral nerve lesion impairs motor neuron axonal regeneration across the lesion site. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant animals exhibit a significant reduction in the number of motor neurons. Neonatal mutants fail to suckle and die within 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Art5 C T 7: 101,747,116 (GRCm39) R123H probably damaging Het
Azin2 A G 4: 128,843,489 (GRCm39) S66P probably damaging Het
Cep295 T C 9: 15,239,178 (GRCm39) E1865G probably benign Het
Ces1a A G 8: 93,759,318 (GRCm39) C273R probably damaging Het
Cfap44 A G 16: 44,239,666 (GRCm39) Y571C probably damaging Het
Csmd3 A T 15: 47,868,227 (GRCm39) probably null Het
Cyp2a4 C T 7: 26,014,226 (GRCm39) P468S possibly damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
E130308A19Rik T A 4: 59,690,743 (GRCm39) D192E probably benign Het
Fam184b C T 5: 45,741,520 (GRCm39) R237H probably damaging Het
Fmn1 T A 2: 113,523,375 (GRCm39) Y1247* probably null Het
Grb14 T C 2: 64,747,608 (GRCm39) S18G probably benign Het
Hs2st1 G A 3: 144,170,902 (GRCm39) T90I possibly damaging Het
Mcc A T 18: 44,601,561 (GRCm39) N589K possibly damaging Het
Mff T A 1: 82,719,609 (GRCm39) S196T probably benign Het
Nyap1 C T 5: 137,733,395 (GRCm39) W546* probably null Het
Or13p10 A T 4: 118,523,496 (GRCm39) M261L possibly damaging Het
Ppp2r3d A G 9: 101,089,883 (GRCm39) S147P probably benign Het
Rsph14 T C 10: 74,860,898 (GRCm39) H134R probably benign Het
Slc25a3 G A 10: 90,953,170 (GRCm39) A274V possibly damaging Het
Slc43a2 T A 11: 75,453,688 (GRCm39) W229R probably damaging Het
Slco4c1 C A 1: 96,756,596 (GRCm39) L575F probably damaging Het
Smyd4 T A 11: 75,281,121 (GRCm39) I198N possibly damaging Het
Trpm6 A G 19: 18,773,862 (GRCm39) D413G probably damaging Het
Ush2a A G 1: 188,689,479 (GRCm39) T33A possibly damaging Het
Zfp871 A T 17: 32,994,946 (GRCm39) D57E possibly damaging Het
Zfyve9 T C 4: 108,507,426 (GRCm39) Q1176R probably benign Het
Other mutations in Cntfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1635:Cntfr UTSW 4 41,658,816 (GRCm39) missense probably damaging 1.00
R1795:Cntfr UTSW 4 41,670,841 (GRCm39) critical splice donor site probably null
R2115:Cntfr UTSW 4 41,663,534 (GRCm39) splice site probably null
R2437:Cntfr UTSW 4 41,671,035 (GRCm39) missense probably damaging 0.99
R4056:Cntfr UTSW 4 41,658,900 (GRCm39) missense probably damaging 0.99
R4770:Cntfr UTSW 4 41,663,282 (GRCm39) missense possibly damaging 0.57
R5245:Cntfr UTSW 4 41,670,879 (GRCm39) missense possibly damaging 0.92
R5346:Cntfr UTSW 4 41,675,042 (GRCm39) nonsense probably null
R5436:Cntfr UTSW 4 41,663,322 (GRCm39) missense probably damaging 0.98
R5535:Cntfr UTSW 4 41,663,216 (GRCm39) missense probably benign 0.44
R6275:Cntfr UTSW 4 41,663,216 (GRCm39) missense possibly damaging 0.89
R6749:Cntfr UTSW 4 41,663,232 (GRCm39) missense possibly damaging 0.47
R7626:Cntfr UTSW 4 41,662,013 (GRCm39) missense possibly damaging 0.89
R9006:Cntfr UTSW 4 41,661,971 (GRCm39) critical splice donor site probably null
R9524:Cntfr UTSW 4 41,661,995 (GRCm39) missense probably damaging 1.00
R9736:Cntfr UTSW 4 41,658,290 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTTTCCCAAACCCACGGGATGC -3'
(R):5'- GTAGTTGCCAGAGCTGACAACAGAG -3'

Sequencing Primer
(F):5'- CCTCTCAGACTCACATCGGG -3'
(R):5'- AGAGATGGTGACTGTCAATGG -3'
Posted On 2014-01-15