Incidental Mutation 'R1215:E130308A19Rik'
ID99560
Institutional Source Beutler Lab
Gene Symbol E130308A19Rik
Ensembl Gene ENSMUSG00000045071
Gene NameRIKEN cDNA E130308A19 gene
Synonyms
MMRRC Submission 039284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1215 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59626211-59761439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59690743 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 192 (D192E)
Ref Sequence ENSEMBL: ENSMUSP00000065702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052420] [ENSMUST00000070150]
Predicted Effect probably benign
Transcript: ENSMUST00000052420
AA Change: D192E

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062493
Gene: ENSMUSG00000045071
AA Change: D192E

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:DUF3504 520 673 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070150
AA Change: D192E

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065702
Gene: ENSMUSG00000045071
AA Change: D192E

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
Pfam:DUF3504 532 687 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152797
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Art5 C T 7: 102,097,909 R123H probably damaging Het
Azin2 A G 4: 128,949,696 S66P probably damaging Het
Cep295 T C 9: 15,327,882 E1865G probably benign Het
Ces1a A G 8: 93,032,690 C273R probably damaging Het
Cfap44 A G 16: 44,419,303 Y571C probably damaging Het
Cntfr C A 4: 41,662,064 W226L probably damaging Het
Csmd3 A T 15: 48,004,831 probably null Het
Cyp2a4 C T 7: 26,314,801 P468S possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fam184b C T 5: 45,584,178 R237H probably damaging Het
Fmn1 T A 2: 113,693,030 Y1247* probably null Het
Grb14 T C 2: 64,917,264 S18G probably benign Het
Hs2st1 G A 3: 144,465,141 T90I possibly damaging Het
Mcc A T 18: 44,468,494 N589K possibly damaging Het
Mff T A 1: 82,741,888 S196T probably benign Het
Nyap1 C T 5: 137,735,133 W546* probably null Het
Olfr62 A T 4: 118,666,299 M261L possibly damaging Het
Ppp2r3a A G 9: 101,212,684 S147P probably benign Het
Rsph14 T C 10: 75,025,066 H134R probably benign Het
Slc25a3 G A 10: 91,117,308 A274V possibly damaging Het
Slc43a2 T A 11: 75,562,862 W229R probably damaging Het
Slco4c1 C A 1: 96,828,871 L575F probably damaging Het
Smyd4 T A 11: 75,390,295 I198N possibly damaging Het
Trpm6 A G 19: 18,796,498 D413G probably damaging Het
Ush2a A G 1: 188,957,282 T33A possibly damaging Het
Zfp871 A T 17: 32,775,972 D57E possibly damaging Het
Zfyve9 T C 4: 108,650,229 Q1176R probably benign Het
Other mutations in E130308A19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:E130308A19Rik APN 4 59737743 splice site probably benign
IGL00672:E130308A19Rik APN 4 59719697 missense probably benign 0.00
IGL00937:E130308A19Rik APN 4 59690846 missense probably benign 0.01
IGL01885:E130308A19Rik APN 4 59720004 missense probably benign 0.20
IGL02638:E130308A19Rik APN 4 59719676 nonsense probably null
H8562:E130308A19Rik UTSW 4 59691033 missense possibly damaging 0.70
R0044:E130308A19Rik UTSW 4 59690290 missense possibly damaging 0.86
R0523:E130308A19Rik UTSW 4 59719716 missense probably damaging 0.98
R0788:E130308A19Rik UTSW 4 59719847 missense possibly damaging 0.76
R1490:E130308A19Rik UTSW 4 59719746 missense probably damaging 0.99
R2292:E130308A19Rik UTSW 4 59690579 missense probably damaging 0.99
R3907:E130308A19Rik UTSW 4 59752393 missense probably benign 0.14
R4288:E130308A19Rik UTSW 4 59690308 missense probably benign 0.33
R4780:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4781:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4834:E130308A19Rik UTSW 4 59690317 nonsense probably null
R4985:E130308A19Rik UTSW 4 59691017 missense probably benign 0.01
R6123:E130308A19Rik UTSW 4 59737565 missense probably damaging 1.00
R6290:E130308A19Rik UTSW 4 59691332 missense probably benign 0.25
R6315:E130308A19Rik UTSW 4 59691132 missense probably benign
R6643:E130308A19Rik UTSW 4 59720561 missense possibly damaging 0.90
R6763:E130308A19Rik UTSW 4 59752288 missense probably damaging 0.99
R6980:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7036:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7078:E130308A19Rik UTSW 4 59737688 missense probably damaging 1.00
R7098:E130308A19Rik UTSW 4 59753004 missense possibly damaging 0.88
R7171:E130308A19Rik UTSW 4 59690333 missense probably damaging 1.00
R7247:E130308A19Rik UTSW 4 59690502 missense probably damaging 1.00
R7366:E130308A19Rik UTSW 4 59752770 missense probably damaging 0.99
R7916:E130308A19Rik UTSW 4 59719841 missense probably damaging 1.00
R8050:E130308A19Rik UTSW 4 59719767 missense probably damaging 1.00
R8445:E130308A19Rik UTSW 4 59720526 missense probably damaging 0.99
Z1176:E130308A19Rik UTSW 4 59720313 missense probably damaging 1.00
Z1177:E130308A19Rik UTSW 4 59720223 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAGCCCTCTGAACTGGATGAAG -3'
(R):5'- TGAAGCCAGAGATACCCTAGCAGTC -3'

Sequencing Primer
(F):5'- CTCTGAACTGGATGAAGCTGTC -3'
(R):5'- CAGAGATACCCTAGCAGTCTTTGG -3'
Posted On2014-01-15