Incidental Mutation 'R1172:Fsd2'
ID99561
Institutional Source Beutler Lab
Gene Symbol Fsd2
Ensembl Gene ENSMUSG00000038663
Gene Namefibronectin type III and SPRY domain containing 2
SynonymsSpryd1, 9830160G03Rik
MMRRC Submission 039245-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1172 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81533308-81566944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81559770 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 108 (D108G)
Ref Sequence ENSEMBL: ENSMUSP00000047775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042318]
Predicted Effect probably benign
Transcript: ENSMUST00000042318
AA Change: D108G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047775
Gene: ENSMUSG00000038663
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 102 121 N/A INTRINSIC
coiled coil region 204 231 N/A INTRINSIC
FN3 315 400 7.34e-9 SMART
FN3 412 494 2e-1 SMART
Pfam:PRY 509 558 8.6e-9 PFAM
Pfam:SPRY 564 683 2.8e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FN3/SPRY family of proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C A 4: 35,218,630 E76D probably damaging Het
Accsl A T 2: 93,866,244 probably benign Het
Adam7 T G 14: 68,514,921 K371N probably damaging Het
Adgrv1 A T 13: 81,557,063 S1543T probably damaging Het
Agbl4 A T 4: 111,656,318 probably benign Het
Arid1b T A 17: 5,339,300 I1707N probably damaging Het
Atp10a T C 7: 58,803,766 V864A probably benign Het
Bivm A G 1: 44,126,782 T131A probably benign Het
Bst1 A G 5: 43,825,408 probably null Het
Cblb T C 16: 52,186,240 probably benign Het
Ccdc28b T C 4: 129,620,889 probably benign Het
Cmas G T 6: 142,756,878 G36C probably benign Het
Eml6 A G 11: 29,749,824 S1771P possibly damaging Het
Epc1 A C 18: 6,490,525 Y31D probably damaging Het
Fbn1 A T 2: 125,394,687 C358S probably benign Het
Fbxl13 A T 5: 21,620,604 probably benign Het
Fermt2 T C 14: 45,459,968 D642G possibly damaging Het
Fmnl2 A T 2: 53,072,274 N257I probably damaging Het
Fry G A 5: 150,481,494 W793* probably null Het
Glipr1l2 C A 10: 112,083,466 L31I possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21718 T C 14: 51,315,891 noncoding transcript Het
Gpld1 A G 13: 24,957,566 probably null Het
Gtf3c2 A T 5: 31,168,075 Y500N probably damaging Het
Hbs1l A G 10: 21,304,638 D73G probably damaging Het
Idh1 G T 1: 65,161,160 N348K probably benign Het
Kank4 T C 4: 98,765,569 Y874C probably damaging Het
Lamc2 A T 1: 153,166,287 S34T probably damaging Het
Laptm4a T C 12: 8,936,716 V258A probably damaging Het
Lrrc19 A T 4: 94,638,389 Y310* probably null Het
Map3k5 G A 10: 20,056,648 probably benign Het
Map7 G A 10: 20,245,299 E92K probably damaging Het
Mettl24 G A 10: 40,737,708 A148T probably benign Het
Mosmo A G 7: 120,730,522 Y122C probably benign Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 T C 14: 69,191,985 S151P probably damaging Het
Npm2 T A 14: 70,652,221 K54* probably null Het
Npr1 T A 3: 90,461,382 D457V probably benign Het
Nudt21 T C 8: 94,031,129 probably benign Het
Pcnt A T 10: 76,393,044 probably null Het
Pik3r4 G T 9: 105,663,174 G754C probably damaging Het
Rftn2 A G 1: 55,211,217 V123A probably damaging Het
Rpa1 A T 11: 75,312,393 V392D probably damaging Het
Rxfp2 T C 5: 150,051,556 V210A probably benign Het
Slc45a4 C T 15: 73,605,429 probably benign Het
Syndig1l T A 12: 84,679,168 probably null Het
Tctn1 G A 5: 122,251,689 R257* probably null Het
Tenm4 A T 7: 96,848,044 E1179V probably damaging Het
Txlnb A G 10: 17,842,756 N445S probably benign Het
Tyrp1 C T 4: 80,844,868 Q331* probably null Het
Ubap2l A T 3: 90,023,500 S413T probably benign Het
Vdr A T 15: 97,869,333 Y185N probably benign Het
Vmn2r66 G T 7: 85,005,591 D503E probably benign Het
Vmn2r72 T A 7: 85,751,944 E89V probably damaging Het
Vmn2r87 T C 10: 130,477,584 T438A probably benign Het
Xrcc6 A G 15: 82,031,163 D94G probably damaging Het
Ywhaq T C 12: 21,395,023 N207S probably benign Het
Zfp185 A T X: 72,999,323 E138D possibly damaging Het
Zfp981 G A 4: 146,537,764 S382N probably benign Het
Other mutations in Fsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Fsd2 APN 7 81553007 missense probably benign 0.15
IGL02012:Fsd2 APN 7 81549914 missense probably benign 0.00
IGL02061:Fsd2 APN 7 81540424 nonsense probably null
IGL02971:Fsd2 APN 7 81548923 nonsense probably null
IGL03207:Fsd2 APN 7 81559170 missense probably benign 0.28
IGL03344:Fsd2 APN 7 81559909 missense probably benign 0.00
R0142:Fsd2 UTSW 7 81559935 missense probably damaging 0.98
R0540:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0607:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0846:Fsd2 UTSW 7 81540397 missense probably benign 0.00
R0863:Fsd2 UTSW 7 81542165 missense possibly damaging 0.47
R1173:Fsd2 UTSW 7 81559770 missense probably benign
R1175:Fsd2 UTSW 7 81559770 missense probably benign
R1438:Fsd2 UTSW 7 81548873 missense probably benign 0.13
R1456:Fsd2 UTSW 7 81559591 nonsense probably null
R1717:Fsd2 UTSW 7 81535109 missense probably benign 0.23
R1987:Fsd2 UTSW 7 81559659 missense possibly damaging 0.89
R2698:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4108:Fsd2 UTSW 7 81544967 missense probably benign 0.01
R4165:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4335:Fsd2 UTSW 7 81542065 missense probably damaging 0.99
R4570:Fsd2 UTSW 7 81559770 missense probably benign
R4707:Fsd2 UTSW 7 81559680 missense probably damaging 1.00
R4741:Fsd2 UTSW 7 81551895 critical splice donor site probably null
R4863:Fsd2 UTSW 7 81552964 missense probably null 0.91
R5281:Fsd2 UTSW 7 81552985 missense probably benign 0.15
R5898:Fsd2 UTSW 7 81537227 missense probably damaging 1.00
R6812:Fsd2 UTSW 7 81535089 missense probably benign 0.00
R7367:Fsd2 UTSW 7 81535180 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15