Incidental Mutation 'R1215:Fam184b'
ID99568
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Namefamily with sequence similarity 184, member B
Synonyms9630031F12Rik
MMRRC Submission 039284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1215 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location45529705-45639614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45584178 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 237 (R237H)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023]
Predicted Effect probably damaging
Transcript: ENSMUST00000016023
AA Change: R237H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: R237H

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Art5 C T 7: 102,097,909 R123H probably damaging Het
Azin2 A G 4: 128,949,696 S66P probably damaging Het
Cep295 T C 9: 15,327,882 E1865G probably benign Het
Ces1a A G 8: 93,032,690 C273R probably damaging Het
Cfap44 A G 16: 44,419,303 Y571C probably damaging Het
Cntfr C A 4: 41,662,064 W226L probably damaging Het
Csmd3 A T 15: 48,004,831 probably null Het
Cyp2a4 C T 7: 26,314,801 P468S possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E130308A19Rik T A 4: 59,690,743 D192E probably benign Het
Fmn1 T A 2: 113,693,030 Y1247* probably null Het
Grb14 T C 2: 64,917,264 S18G probably benign Het
Hs2st1 G A 3: 144,465,141 T90I possibly damaging Het
Mcc A T 18: 44,468,494 N589K possibly damaging Het
Mff T A 1: 82,741,888 S196T probably benign Het
Nyap1 C T 5: 137,735,133 W546* probably null Het
Olfr62 A T 4: 118,666,299 M261L possibly damaging Het
Ppp2r3a A G 9: 101,212,684 S147P probably benign Het
Rsph14 T C 10: 75,025,066 H134R probably benign Het
Slc25a3 G A 10: 91,117,308 A274V possibly damaging Het
Slc43a2 T A 11: 75,562,862 W229R probably damaging Het
Slco4c1 C A 1: 96,828,871 L575F probably damaging Het
Smyd4 T A 11: 75,390,295 I198N possibly damaging Het
Trpm6 A G 19: 18,796,498 D413G probably damaging Het
Ush2a A G 1: 188,957,282 T33A possibly damaging Het
Zfp871 A T 17: 32,775,972 D57E possibly damaging Het
Zfyve9 T C 4: 108,650,229 Q1176R probably benign Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45539749 missense probably benign 0.17
IGL00781:Fam184b APN 5 45555192 splice site probably null
IGL01636:Fam184b APN 5 45584295 missense probably benign 0.00
IGL02008:Fam184b APN 5 45532823 missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45639151 missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45532815 nonsense probably null
IGL02192:Fam184b APN 5 45537720 missense probably benign 0.00
IGL02478:Fam184b APN 5 45537697 missense probably damaging 0.99
IGL03368:Fam184b APN 5 45531824 missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45555194 splice site probably benign
R0129:Fam184b UTSW 5 45532778 missense probably damaging 1.00
R0420:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R0647:Fam184b UTSW 5 45584590 missense probably benign
R1374:Fam184b UTSW 5 45555143 missense probably benign
R1466:Fam184b UTSW 5 45580509 splice site probably benign
R1773:Fam184b UTSW 5 45584334 missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45531889 missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45539764 missense probably benign 0.00
R4375:Fam184b UTSW 5 45542343 missense probably benign
R4674:Fam184b UTSW 5 45582888 nonsense probably null
R4942:Fam184b UTSW 5 45573307 missense probably damaging 0.97
R5021:Fam184b UTSW 5 45573262 missense probably benign 0.01
R5450:Fam184b UTSW 5 45539801 missense probably benign
R5731:Fam184b UTSW 5 45553129 missense probably benign 0.00
R5858:Fam184b UTSW 5 45639119 missense probably damaging 0.99
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6060:Fam184b UTSW 5 45553147 missense probably damaging 0.99
R6088:Fam184b UTSW 5 45584012 missense probably damaging 1.00
R6416:Fam184b UTSW 5 45537653 missense probably benign 0.04
R6932:Fam184b UTSW 5 45532901 splice site probably null
R6956:Fam184b UTSW 5 45530757 missense probably damaging 0.97
R6965:Fam184b UTSW 5 45555135 missense probably benign
R7229:Fam184b UTSW 5 45584175 missense probably damaging 1.00
R7303:Fam184b UTSW 5 45542226 critical splice donor site probably null
R7429:Fam184b UTSW 5 45540888 missense probably benign
R7522:Fam184b UTSW 5 45530751 missense probably damaging 1.00
R7541:Fam184b UTSW 5 45542232 missense probably damaging 0.99
R7942:Fam184b UTSW 5 45584253 missense probably benign 0.16
R8172:Fam184b UTSW 5 45584367 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCAGCAACTTTGCCTATTATCCCC -3'
(R):5'- CGCATTCAGACCCTGGAAAATGCC -3'

Sequencing Primer
(F):5'- GTTCTTTCAACTTCTGGGCATAC -3'
(R):5'- TGCTGAACGAGTCCTGATAC -3'
Posted On2014-01-15