Incidental Mutation 'R1172:Nudt21'
ID99573
Institutional Source Beutler Lab
Gene Symbol Nudt21
Ensembl Gene ENSMUSG00000031754
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 21
Synonyms25kDa, Cpsf5, 5730530J16Rik, 3110048P04Rik
MMRRC Submission 039245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1172 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94015496-94037031 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 94031129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034204] [ENSMUST00000212622] [ENSMUST00000212911] [ENSMUST00000212981]
Predicted Effect probably benign
Transcript: ENSMUST00000034204
SMART Domains Protein: ENSMUSP00000034204
Gene: ENSMUSG00000031754

DomainStartEndE-ValueType
Pfam:NUDIX_2 35 222 9.9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212622
Predicted Effect probably benign
Transcript: ENSMUST00000212911
Predicted Effect probably benign
Transcript: ENSMUST00000212981
Meta Mutation Damage Score 0.1344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. This gene encodes the 25kD subunit of the protein complex, which is composed of four polypeptides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C A 4: 35,218,630 E76D probably damaging Het
Accsl A T 2: 93,866,244 probably benign Het
Adam7 T G 14: 68,514,921 K371N probably damaging Het
Adgrv1 A T 13: 81,557,063 S1543T probably damaging Het
Agbl4 A T 4: 111,656,318 probably benign Het
Arid1b T A 17: 5,339,300 I1707N probably damaging Het
Atp10a T C 7: 58,803,766 V864A probably benign Het
Bivm A G 1: 44,126,782 T131A probably benign Het
Bst1 A G 5: 43,825,408 probably null Het
Cblb T C 16: 52,186,240 probably benign Het
Ccdc28b T C 4: 129,620,889 probably benign Het
Cmas G T 6: 142,756,878 G36C probably benign Het
Eml6 A G 11: 29,749,824 S1771P possibly damaging Het
Epc1 A C 18: 6,490,525 Y31D probably damaging Het
Fbn1 A T 2: 125,394,687 C358S probably benign Het
Fbxl13 A T 5: 21,620,604 probably benign Het
Fermt2 T C 14: 45,459,968 D642G possibly damaging Het
Fmnl2 A T 2: 53,072,274 N257I probably damaging Het
Fry G A 5: 150,481,494 W793* probably null Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Glipr1l2 C A 10: 112,083,466 L31I possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21718 T C 14: 51,315,891 noncoding transcript Het
Gpld1 A G 13: 24,957,566 probably null Het
Gtf3c2 A T 5: 31,168,075 Y500N probably damaging Het
Hbs1l A G 10: 21,304,638 D73G probably damaging Het
Idh1 G T 1: 65,161,160 N348K probably benign Het
Kank4 T C 4: 98,765,569 Y874C probably damaging Het
Lamc2 A T 1: 153,166,287 S34T probably damaging Het
Laptm4a T C 12: 8,936,716 V258A probably damaging Het
Lrrc19 A T 4: 94,638,389 Y310* probably null Het
Map3k5 G A 10: 20,056,648 probably benign Het
Map7 G A 10: 20,245,299 E92K probably damaging Het
Mettl24 G A 10: 40,737,708 A148T probably benign Het
Mosmo A G 7: 120,730,522 Y122C probably benign Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 T C 14: 69,191,985 S151P probably damaging Het
Npm2 T A 14: 70,652,221 K54* probably null Het
Npr1 T A 3: 90,461,382 D457V probably benign Het
Pcnt A T 10: 76,393,044 probably null Het
Pik3r4 G T 9: 105,663,174 G754C probably damaging Het
Rftn2 A G 1: 55,211,217 V123A probably damaging Het
Rpa1 A T 11: 75,312,393 V392D probably damaging Het
Rxfp2 T C 5: 150,051,556 V210A probably benign Het
Slc45a4 C T 15: 73,605,429 probably benign Het
Syndig1l T A 12: 84,679,168 probably null Het
Tctn1 G A 5: 122,251,689 R257* probably null Het
Tenm4 A T 7: 96,848,044 E1179V probably damaging Het
Txlnb A G 10: 17,842,756 N445S probably benign Het
Tyrp1 C T 4: 80,844,868 Q331* probably null Het
Ubap2l A T 3: 90,023,500 S413T probably benign Het
Vdr A T 15: 97,869,333 Y185N probably benign Het
Vmn2r66 G T 7: 85,005,591 D503E probably benign Het
Vmn2r72 T A 7: 85,751,944 E89V probably damaging Het
Vmn2r87 T C 10: 130,477,584 T438A probably benign Het
Xrcc6 A G 15: 82,031,163 D94G probably damaging Het
Ywhaq T C 12: 21,395,023 N207S probably benign Het
Zfp185 A T X: 72,999,323 E138D possibly damaging Het
Zfp981 G A 4: 146,537,764 S382N probably benign Het
Other mutations in Nudt21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nudt21 APN 8 94019701 nonsense probably null
PIT4544001:Nudt21 UTSW 8 94019597 missense unknown
R1576:Nudt21 UTSW 8 94028833 critical splice donor site probably null
R6293:Nudt21 UTSW 8 94028878 missense probably damaging 1.00
R6474:Nudt21 UTSW 8 94019654 missense probably benign 0.02
R6961:Nudt21 UTSW 8 94028880 missense probably benign
R7312:Nudt21 UTSW 8 94019599 missense probably benign 0.00
Predicted Primers
Posted On2014-01-15