Incidental Mutation 'R1215:Cyp2a4'
ID99574
Institutional Source Beutler Lab
Gene Symbol Cyp2a4
Ensembl Gene ENSMUSG00000074254
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 4
SynonymsD7Ucla4, Cyp15a1, testosterone 15alpha-hydroxylase
MMRRC Submission 039284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1215 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26307169-26315088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26314801 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 468 (P468S)
Ref Sequence ENSEMBL: ENSMUSP00000096254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098657]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098657
AA Change: P468S

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096254
Gene: ENSMUSG00000074254
AA Change: P468S

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 8.9e-151 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Art5 C T 7: 102,097,909 R123H probably damaging Het
Azin2 A G 4: 128,949,696 S66P probably damaging Het
Cep295 T C 9: 15,327,882 E1865G probably benign Het
Ces1a A G 8: 93,032,690 C273R probably damaging Het
Cfap44 A G 16: 44,419,303 Y571C probably damaging Het
Cntfr C A 4: 41,662,064 W226L probably damaging Het
Csmd3 A T 15: 48,004,831 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E130308A19Rik T A 4: 59,690,743 D192E probably benign Het
Fam184b C T 5: 45,584,178 R237H probably damaging Het
Fmn1 T A 2: 113,693,030 Y1247* probably null Het
Grb14 T C 2: 64,917,264 S18G probably benign Het
Hs2st1 G A 3: 144,465,141 T90I possibly damaging Het
Mcc A T 18: 44,468,494 N589K possibly damaging Het
Mff T A 1: 82,741,888 S196T probably benign Het
Nyap1 C T 5: 137,735,133 W546* probably null Het
Olfr62 A T 4: 118,666,299 M261L possibly damaging Het
Ppp2r3a A G 9: 101,212,684 S147P probably benign Het
Rsph14 T C 10: 75,025,066 H134R probably benign Het
Slc25a3 G A 10: 91,117,308 A274V possibly damaging Het
Slc43a2 T A 11: 75,562,862 W229R probably damaging Het
Slco4c1 C A 1: 96,828,871 L575F probably damaging Het
Smyd4 T A 11: 75,390,295 I198N possibly damaging Het
Trpm6 A G 19: 18,796,498 D413G probably damaging Het
Ush2a A G 1: 188,957,282 T33A possibly damaging Het
Zfp871 A T 17: 32,775,972 D57E possibly damaging Het
Zfyve9 T C 4: 108,650,229 Q1176R probably benign Het
Other mutations in Cyp2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Cyp2a4 APN 7 26308544 missense probably damaging 1.00
IGL01609:Cyp2a4 APN 7 26308663 critical splice donor site probably null
IGL01959:Cyp2a4 APN 7 26307708 missense probably damaging 1.00
IGL02282:Cyp2a4 APN 7 26309047 missense probably benign 0.01
IGL03053:Cyp2a4 APN 7 26313550 splice site probably benign
IGL03168:Cyp2a4 APN 7 26313550 splice site probably benign
R0393:Cyp2a4 UTSW 7 26312868 missense possibly damaging 0.67
R0453:Cyp2a4 UTSW 7 26312833 missense probably benign 0.22
R0825:Cyp2a4 UTSW 7 26312916 missense probably benign 0.07
R0948:Cyp2a4 UTSW 7 26310788 missense probably damaging 1.00
R1222:Cyp2a4 UTSW 7 26308588 missense possibly damaging 0.70
R1374:Cyp2a4 UTSW 7 26312923 missense probably damaging 0.99
R1473:Cyp2a4 UTSW 7 26314763 missense probably benign
R1580:Cyp2a4 UTSW 7 26307651 missense possibly damaging 0.91
R1768:Cyp2a4 UTSW 7 26312772 missense possibly damaging 0.94
R1832:Cyp2a4 UTSW 7 26312210 missense probably damaging 0.99
R1911:Cyp2a4 UTSW 7 26308974 missense possibly damaging 0.85
R2080:Cyp2a4 UTSW 7 26308537 missense possibly damaging 0.96
R2086:Cyp2a4 UTSW 7 26312308 missense probably damaging 1.00
R2259:Cyp2a4 UTSW 7 26309035 missense probably damaging 0.99
R2877:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R2878:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3733:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3734:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3741:Cyp2a4 UTSW 7 26308544 missense probably damaging 1.00
R4079:Cyp2a4 UTSW 7 26307366 missense probably benign 0.22
R4297:Cyp2a4 UTSW 7 26307368 missense probably damaging 0.96
R4785:Cyp2a4 UTSW 7 26312875 missense probably damaging 1.00
R4998:Cyp2a4 UTSW 7 26307361 missense probably damaging 1.00
R5297:Cyp2a4 UTSW 7 26312204 missense probably benign 0.07
R5893:Cyp2a4 UTSW 7 26308928 missense probably damaging 1.00
R5942:Cyp2a4 UTSW 7 26310704 critical splice acceptor site probably null
R6262:Cyp2a4 UTSW 7 26312230 missense probably damaging 0.99
R6612:Cyp2a4 UTSW 7 26308647 missense probably benign 0.00
R6722:Cyp2a4 UTSW 7 26313558 missense probably benign 0.04
R7064:Cyp2a4 UTSW 7 26312307 missense probably benign 0.02
R7419:Cyp2a4 UTSW 7 26314763 missense probably benign 0.00
R7562:Cyp2a4 UTSW 7 26312896 missense possibly damaging 0.88
R8231:Cyp2a4 UTSW 7 26312937 missense probably benign 0.00
R8750:Cyp2a4 UTSW 7 26312784 missense probably benign 0.00
Z1176:Cyp2a4 UTSW 7 26307323 nonsense probably null
Z1176:Cyp2a4 UTSW 7 26310841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACAGCCTGGTGTGGATCAAC -3'
(R):5'- CTGCAAGTCTACGAAGTGTCCTCTG -3'

Sequencing Primer
(F):5'- GAGCTTTCCTTAAAGATCTCAGCAC -3'
(R):5'- ACGAAGTGTCCTCTGTTTCTTCTG -3'
Posted On2014-01-15