Incidental Mutation 'R1215:Ces1a'
ID99578
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Namecarboxylesterase 1A
SynonymsGm4976
MMRRC Submission 039284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1215 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93020214-93048192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93032690 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 273 (C273R)
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
Predicted Effect probably damaging
Transcript: ENSMUST00000095211
AA Change: C273R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047
AA Change: C273R

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210764
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Art5 C T 7: 102,097,909 R123H probably damaging Het
Azin2 A G 4: 128,949,696 S66P probably damaging Het
Cep295 T C 9: 15,327,882 E1865G probably benign Het
Cfap44 A G 16: 44,419,303 Y571C probably damaging Het
Cntfr C A 4: 41,662,064 W226L probably damaging Het
Csmd3 A T 15: 48,004,831 probably null Het
Cyp2a4 C T 7: 26,314,801 P468S possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E130308A19Rik T A 4: 59,690,743 D192E probably benign Het
Fam184b C T 5: 45,584,178 R237H probably damaging Het
Fmn1 T A 2: 113,693,030 Y1247* probably null Het
Grb14 T C 2: 64,917,264 S18G probably benign Het
Hs2st1 G A 3: 144,465,141 T90I possibly damaging Het
Mcc A T 18: 44,468,494 N589K possibly damaging Het
Mff T A 1: 82,741,888 S196T probably benign Het
Nyap1 C T 5: 137,735,133 W546* probably null Het
Olfr62 A T 4: 118,666,299 M261L possibly damaging Het
Ppp2r3a A G 9: 101,212,684 S147P probably benign Het
Rsph14 T C 10: 75,025,066 H134R probably benign Het
Slc25a3 G A 10: 91,117,308 A274V possibly damaging Het
Slc43a2 T A 11: 75,562,862 W229R probably damaging Het
Slco4c1 C A 1: 96,828,871 L575F probably damaging Het
Smyd4 T A 11: 75,390,295 I198N possibly damaging Het
Trpm6 A G 19: 18,796,498 D413G probably damaging Het
Ush2a A G 1: 188,957,282 T33A possibly damaging Het
Zfp871 A T 17: 32,775,972 D57E possibly damaging Het
Zfyve9 T C 4: 108,650,229 Q1176R probably benign Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93020467 missense probably damaging 1.00
IGL00556:Ces1a APN 8 93045059 missense probably benign 0.03
IGL00841:Ces1a APN 8 93039536 nonsense probably null
IGL01510:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01511:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01518:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01519:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01520:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01526:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01527:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01828:Ces1a APN 8 93025201 missense probably damaging 0.96
IGL01934:Ces1a APN 8 93032650 missense probably damaging 0.99
IGL02456:Ces1a APN 8 93039498 missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93036040 missense probably damaging 1.00
IGL02982:Ces1a APN 8 93044975 missense probably damaging 1.00
IGL03178:Ces1a APN 8 93020889 missense probably damaging 1.00
IGL03377:Ces1a APN 8 93039488 missense probably damaging 1.00
R0556:Ces1a UTSW 8 93045112 missense probably benign 0.01
R0613:Ces1a UTSW 8 93025581 missense probably benign 0.11
R0627:Ces1a UTSW 8 93042043 missense probably benign 0.03
R0686:Ces1a UTSW 8 93022449 missense probably damaging 1.00
R0724:Ces1a UTSW 8 93039513 missense probably damaging 0.98
R0930:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1063:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1381:Ces1a UTSW 8 93034031 missense probably damaging 0.98
R1417:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1850:Ces1a UTSW 8 93027326 missense probably damaging 1.00
R2072:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2074:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2075:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2114:Ces1a UTSW 8 93039551 missense possibly damaging 0.93
R2213:Ces1a UTSW 8 93025225 missense probably damaging 1.00
R2346:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2347:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2483:Ces1a UTSW 8 93027341 missense probably damaging 1.00
R4515:Ces1a UTSW 8 93020904 missense probably damaging 1.00
R4587:Ces1a UTSW 8 93025304 missense probably damaging 1.00
R4691:Ces1a UTSW 8 93032659 missense probably benign 0.00
R4992:Ces1a UTSW 8 93045022 missense probably benign 0.08
R5074:Ces1a UTSW 8 93032675 missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93027353 missense probably benign 0.03
R7390:Ces1a UTSW 8 93044841 splice site probably null
Z1088:Ces1a UTSW 8 93025607 missense probably benign 0.02
Z1176:Ces1a UTSW 8 93036085 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CTGACACTGTCCATGAAAAGTCCCC -3'
(R):5'- GCTTCTAGCCACTGACTCACACTG -3'

Sequencing Primer
(F):5'- TGTCCATGAAAAGTCCCCATGTAG -3'
(R):5'- AGCGTACCCATGTTATCAGAG -3'
Posted On2014-01-15