Mutagenetix > Incidental Mutations

Incidental Mutation 'R1172:Rpa1'

99597

Institutional Source

Beutler Lab

Gene Symbol

Rpa1

Ensembl Gene

ENSMUSG00000000751

Gene Name

replication protein A1

Synonyms

Rpa, 5031405K23Rik, RP-A, RF-A, 70kDa

MMRRC Submission

039245-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1172 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75298166-75348324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75312393 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 392 (V392D)

Ref Sequence

ENSEMBL: ENSMUSP00000090585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]

Predicted Effect

probably damaging
Transcript: ENSMUST00000000767
AA Change: V413D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: V413D

Domain	Start	End	E-Value	Type
Pfam:Rep-A_N	5	93	7.2e-30	PFAM
low complexity region	145	175	N/A	INTRINSIC
Pfam:tRNA_anti-codon	227	316	5e-13	PFAM
Pfam:REPA_OB_2	335	432	5e-37	PFAM
Pfam:Rep_fac-A_C	491	636	4.5e-57	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000092907
AA Change: V392D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: V392D

Domain	Start	End	E-Value	Type
Pfam:Rep-A_N	5	104	4.3e-35	PFAM
low complexity region	124	154	N/A	INTRINSIC
Pfam:tRNA_anti-codon	206	295	8.4e-13	PFAM
SCOP:d1fgua2	308	435	8e-46	SMART
Pfam:Rep_fac-A_C	470	615	9.2e-56	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135770

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154894

Meta Mutation Damage Score

0.9238

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (62/63)

MGI Phenotype

PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	C	A	4: 35,218,630	E76D	probably damaging	Het
Accsl	A	T	2: 93,866,244		probably benign	Het
Adam7	T	G	14: 68,514,921	K371N	probably damaging	Het
Adgrv1	A	T	13: 81,557,063	S1543T	probably damaging	Het
Agbl4	A	T	4: 111,656,318		probably benign	Het
Arid1b	T	A	17: 5,339,300	I1707N	probably damaging	Het
Atp10a	T	C	7: 58,803,766	V864A	probably benign	Het
Bivm	A	G	1: 44,126,782	T131A	probably benign	Het
Bst1	A	G	5: 43,825,408		probably null	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Ccdc28b	T	C	4: 129,620,889		probably benign	Het
Cmas	G	T	6: 142,756,878	G36C	probably benign	Het
Eml6	A	G	11: 29,749,824	S1771P	possibly damaging	Het
Epc1	A	C	18: 6,490,525	Y31D	probably damaging	Het
Fbn1	A	T	2: 125,394,687	C358S	probably benign	Het
Fbxl13	A	T	5: 21,620,604		probably benign	Het
Fermt2	T	C	14: 45,459,968	D642G	possibly damaging	Het
Fmnl2	A	T	2: 53,072,274	N257I	probably damaging	Het
Fry	G	A	5: 150,481,494	W793*	probably null	Het
Fsd2	T	C	7: 81,559,770	D108G	probably benign	Het
Glipr1l2	C	A	10: 112,083,466	L31I	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm10801	C	T	2: 98,663,907		probably benign	Het
Gm21718	T	C	14: 51,315,891		noncoding transcript	Het
Gpld1	A	G	13: 24,957,566		probably null	Het
Gtf3c2	A	T	5: 31,168,075	Y500N	probably damaging	Het
Hbs1l	A	G	10: 21,304,638	D73G	probably damaging	Het
Idh1	G	T	1: 65,161,160	N348K	probably benign	Het
Kank4	T	C	4: 98,765,569	Y874C	probably damaging	Het
Lamc2	A	T	1: 153,166,287	S34T	probably damaging	Het
Laptm4a	T	C	12: 8,936,716	V258A	probably damaging	Het
Lrrc19	A	T	4: 94,638,389	Y310*	probably null	Het
Map3k5	G	A	10: 20,056,648		probably benign	Het
Map7	G	A	10: 20,245,299	E92K	probably damaging	Het
Mettl24	G	A	10: 40,737,708	A148T	probably benign	Het
Mosmo	A	G	7: 120,730,522	Y122C	probably benign	Het
Ncr1	T	A	7: 4,338,121	I37N	probably benign	Het
Nkx3-1	T	C	14: 69,191,985	S151P	probably damaging	Het
Npm2	T	A	14: 70,652,221	K54*	probably null	Het
Npr1	T	A	3: 90,461,382	D457V	probably benign	Het
Nudt21	T	C	8: 94,031,129		probably benign	Het
Pcnt	A	T	10: 76,393,044		probably null	Het
Pik3r4	G	T	9: 105,663,174	G754C	probably damaging	Het
Rftn2	A	G	1: 55,211,217	V123A	probably damaging	Het
Rxfp2	T	C	5: 150,051,556	V210A	probably benign	Het
Slc45a4	C	T	15: 73,605,429		probably benign	Het
Syndig1l	T	A	12: 84,679,168		probably null	Het
Tctn1	G	A	5: 122,251,689	R257*	probably null	Het
Tenm4	A	T	7: 96,848,044	E1179V	probably damaging	Het
Txlnb	A	G	10: 17,842,756	N445S	probably benign	Het
Tyrp1	C	T	4: 80,844,868	Q331*	probably null	Het
Ubap2l	A	T	3: 90,023,500	S413T	probably benign	Het
Vdr	A	T	15: 97,869,333	Y185N	probably benign	Het
Vmn2r66	G	T	7: 85,005,591	D503E	probably benign	Het
Vmn2r72	T	A	7: 85,751,944	E89V	probably damaging	Het
Vmn2r87	T	C	10: 130,477,584	T438A	probably benign	Het
Xrcc6	A	G	15: 82,031,163	D94G	probably damaging	Het
Ywhaq	T	C	12: 21,395,023	N207S	probably benign	Het
Zfp185	A	T	X: 72,999,323	E138D	possibly damaging	Het
Zfp981	G	A	4: 146,537,764	S382N	probably benign	Het

Other mutations in Rpa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01296:Rpa1	APN	11	75312315	missense	probably damaging	1.00
IGL01347:Rpa1	APN	11	75307285	missense	probably damaging	1.00
IGL02976:Rpa1	APN	11	75312802	missense	probably damaging	0.99
IGL03169:Rpa1	APN	11	75301357	missense	probably damaging	0.97
FR4976:Rpa1	UTSW	11	75318519	small deletion	probably benign
PIT4576001:Rpa1	UTSW	11	75313158	missense	probably damaging	1.00
R0017:Rpa1	UTSW	11	75314861	missense	probably null	1.00
R0017:Rpa1	UTSW	11	75314861	missense	probably null	1.00
R0126:Rpa1	UTSW	11	75318529	missense	probably benign	0.00
R0240:Rpa1	UTSW	11	75328687	missense	probably benign	0.01
R0240:Rpa1	UTSW	11	75328687	missense	probably benign	0.01
R0465:Rpa1	UTSW	11	75313095	missense	probably damaging	0.99
R0718:Rpa1	UTSW	11	75318401	splice site	probably benign
R0973:Rpa1	UTSW	11	75312973	splice site	probably null
R1055:Rpa1	UTSW	11	75302732	missense	probably damaging	1.00
R1642:Rpa1	UTSW	11	75312691	critical splice donor site	probably null
R1883:Rpa1	UTSW	11	75318483	missense	probably benign
R1975:Rpa1	UTSW	11	75306176	missense	probably damaging	1.00
R5008:Rpa1	UTSW	11	75313299	critical splice donor site	probably null
R5279:Rpa1	UTSW	11	75313344	missense	probably damaging	0.96
R6083:Rpa1	UTSW	11	75314911	missense	probably damaging	1.00
R6161:Rpa1	UTSW	11	75314895	missense	probably damaging	1.00
R6187:Rpa1	UTSW	11	75310236	missense	probably benign	0.00
R6762:Rpa1	UTSW	11	75340345	missense	possibly damaging	0.89
R6828:Rpa1	UTSW	11	75314871	missense	probably damaging	1.00
R7044:Rpa1	UTSW	11	75312802	missense	probably damaging	0.99
R7331:Rpa1	UTSW	11	75313115	missense	probably damaging	0.98
R7798:Rpa1	UTSW	11	75312809	missense	probably damaging	0.96
R7890:Rpa1	UTSW	11	75307224	frame shift	probably null
R7973:Rpa1	UTSW	11	75307224	frame shift	probably null
RF018:Rpa1	UTSW	11	75318517	frame shift	probably null

Predicted Primers

Posted On

2014-01-15