Incidental Mutation 'R1172:Rpa1'
ID99597
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Namereplication protein A1
SynonymsRpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission 039245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1172 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75298166-75348324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75312393 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 392 (V392D)
Ref Sequence ENSEMBL: ENSMUSP00000090585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
Predicted Effect probably damaging
Transcript: ENSMUST00000000767
AA Change: V413D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: V413D

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092907
AA Change: V392D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: V392D

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154894
Meta Mutation Damage Score 0.9238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C A 4: 35,218,630 E76D probably damaging Het
Accsl A T 2: 93,866,244 probably benign Het
Adam7 T G 14: 68,514,921 K371N probably damaging Het
Adgrv1 A T 13: 81,557,063 S1543T probably damaging Het
Agbl4 A T 4: 111,656,318 probably benign Het
Arid1b T A 17: 5,339,300 I1707N probably damaging Het
Atp10a T C 7: 58,803,766 V864A probably benign Het
Bivm A G 1: 44,126,782 T131A probably benign Het
Bst1 A G 5: 43,825,408 probably null Het
Cblb T C 16: 52,186,240 probably benign Het
Ccdc28b T C 4: 129,620,889 probably benign Het
Cmas G T 6: 142,756,878 G36C probably benign Het
Eml6 A G 11: 29,749,824 S1771P possibly damaging Het
Epc1 A C 18: 6,490,525 Y31D probably damaging Het
Fbn1 A T 2: 125,394,687 C358S probably benign Het
Fbxl13 A T 5: 21,620,604 probably benign Het
Fermt2 T C 14: 45,459,968 D642G possibly damaging Het
Fmnl2 A T 2: 53,072,274 N257I probably damaging Het
Fry G A 5: 150,481,494 W793* probably null Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Glipr1l2 C A 10: 112,083,466 L31I possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21718 T C 14: 51,315,891 noncoding transcript Het
Gpld1 A G 13: 24,957,566 probably null Het
Gtf3c2 A T 5: 31,168,075 Y500N probably damaging Het
Hbs1l A G 10: 21,304,638 D73G probably damaging Het
Idh1 G T 1: 65,161,160 N348K probably benign Het
Kank4 T C 4: 98,765,569 Y874C probably damaging Het
Lamc2 A T 1: 153,166,287 S34T probably damaging Het
Laptm4a T C 12: 8,936,716 V258A probably damaging Het
Lrrc19 A T 4: 94,638,389 Y310* probably null Het
Map3k5 G A 10: 20,056,648 probably benign Het
Map7 G A 10: 20,245,299 E92K probably damaging Het
Mettl24 G A 10: 40,737,708 A148T probably benign Het
Mosmo A G 7: 120,730,522 Y122C probably benign Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 T C 14: 69,191,985 S151P probably damaging Het
Npm2 T A 14: 70,652,221 K54* probably null Het
Npr1 T A 3: 90,461,382 D457V probably benign Het
Nudt21 T C 8: 94,031,129 probably benign Het
Pcnt A T 10: 76,393,044 probably null Het
Pik3r4 G T 9: 105,663,174 G754C probably damaging Het
Rftn2 A G 1: 55,211,217 V123A probably damaging Het
Rxfp2 T C 5: 150,051,556 V210A probably benign Het
Slc45a4 C T 15: 73,605,429 probably benign Het
Syndig1l T A 12: 84,679,168 probably null Het
Tctn1 G A 5: 122,251,689 R257* probably null Het
Tenm4 A T 7: 96,848,044 E1179V probably damaging Het
Txlnb A G 10: 17,842,756 N445S probably benign Het
Tyrp1 C T 4: 80,844,868 Q331* probably null Het
Ubap2l A T 3: 90,023,500 S413T probably benign Het
Vdr A T 15: 97,869,333 Y185N probably benign Het
Vmn2r66 G T 7: 85,005,591 D503E probably benign Het
Vmn2r72 T A 7: 85,751,944 E89V probably damaging Het
Vmn2r87 T C 10: 130,477,584 T438A probably benign Het
Xrcc6 A G 15: 82,031,163 D94G probably damaging Het
Ywhaq T C 12: 21,395,023 N207S probably benign Het
Zfp185 A T X: 72,999,323 E138D possibly damaging Het
Zfp981 G A 4: 146,537,764 S382N probably benign Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
R7798:Rpa1 UTSW 11 75312809 missense probably damaging 0.96
R7890:Rpa1 UTSW 11 75307224 frame shift probably null
R7973:Rpa1 UTSW 11 75307224 frame shift probably null
RF018:Rpa1 UTSW 11 75318517 frame shift probably null
Predicted Primers
Posted On2014-01-15