Incidental Mutation 'R1172:Fermt2'
ID99609
Institutional Source Beutler Lab
Gene Symbol Fermt2
Ensembl Gene ENSMUSG00000037712
Gene Namefermitin family member 2
SynonymsPlekhc1, Mig2, Kindlin-2
MMRRC Submission 039245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1172 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45458795-45530118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45459968 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 642 (D642G)
Ref Sequence ENSEMBL: ENSMUSP00000044554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045905
AA Change: D642G

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044554
Gene: ENSMUSG00000037712
AA Change: D642G

DomainStartEndE-ValueType
Blast:B41 16 45 2e-9 BLAST
low complexity region 46 57 N/A INTRINSIC
B41 93 573 5.09e-56 SMART
PH 373 478 2.7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158144
Meta Mutation Damage Score 0.2187 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous mice are embryonic lethal at or before E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C A 4: 35,218,630 E76D probably damaging Het
Accsl A T 2: 93,866,244 probably benign Het
Adam7 T G 14: 68,514,921 K371N probably damaging Het
Adgrv1 A T 13: 81,557,063 S1543T probably damaging Het
Agbl4 A T 4: 111,656,318 probably benign Het
Arid1b T A 17: 5,339,300 I1707N probably damaging Het
Atp10a T C 7: 58,803,766 V864A probably benign Het
Bivm A G 1: 44,126,782 T131A probably benign Het
Bst1 A G 5: 43,825,408 probably null Het
Cblb T C 16: 52,186,240 probably benign Het
Ccdc28b T C 4: 129,620,889 probably benign Het
Cmas G T 6: 142,756,878 G36C probably benign Het
Eml6 A G 11: 29,749,824 S1771P possibly damaging Het
Epc1 A C 18: 6,490,525 Y31D probably damaging Het
Fbn1 A T 2: 125,394,687 C358S probably benign Het
Fbxl13 A T 5: 21,620,604 probably benign Het
Fmnl2 A T 2: 53,072,274 N257I probably damaging Het
Fry G A 5: 150,481,494 W793* probably null Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Glipr1l2 C A 10: 112,083,466 L31I possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21718 T C 14: 51,315,891 noncoding transcript Het
Gpld1 A G 13: 24,957,566 probably null Het
Gtf3c2 A T 5: 31,168,075 Y500N probably damaging Het
Hbs1l A G 10: 21,304,638 D73G probably damaging Het
Idh1 G T 1: 65,161,160 N348K probably benign Het
Kank4 T C 4: 98,765,569 Y874C probably damaging Het
Lamc2 A T 1: 153,166,287 S34T probably damaging Het
Laptm4a T C 12: 8,936,716 V258A probably damaging Het
Lrrc19 A T 4: 94,638,389 Y310* probably null Het
Map3k5 G A 10: 20,056,648 probably benign Het
Map7 G A 10: 20,245,299 E92K probably damaging Het
Mettl24 G A 10: 40,737,708 A148T probably benign Het
Mosmo A G 7: 120,730,522 Y122C probably benign Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 T C 14: 69,191,985 S151P probably damaging Het
Npm2 T A 14: 70,652,221 K54* probably null Het
Npr1 T A 3: 90,461,382 D457V probably benign Het
Nudt21 T C 8: 94,031,129 probably benign Het
Pcnt A T 10: 76,393,044 probably null Het
Pik3r4 G T 9: 105,663,174 G754C probably damaging Het
Rftn2 A G 1: 55,211,217 V123A probably damaging Het
Rpa1 A T 11: 75,312,393 V392D probably damaging Het
Rxfp2 T C 5: 150,051,556 V210A probably benign Het
Slc45a4 C T 15: 73,605,429 probably benign Het
Syndig1l T A 12: 84,679,168 probably null Het
Tctn1 G A 5: 122,251,689 R257* probably null Het
Tenm4 A T 7: 96,848,044 E1179V probably damaging Het
Txlnb A G 10: 17,842,756 N445S probably benign Het
Tyrp1 C T 4: 80,844,868 Q331* probably null Het
Ubap2l A T 3: 90,023,500 S413T probably benign Het
Vdr A T 15: 97,869,333 Y185N probably benign Het
Vmn2r66 G T 7: 85,005,591 D503E probably benign Het
Vmn2r72 T A 7: 85,751,944 E89V probably damaging Het
Vmn2r87 T C 10: 130,477,584 T438A probably benign Het
Xrcc6 A G 15: 82,031,163 D94G probably damaging Het
Ywhaq T C 12: 21,395,023 N207S probably benign Het
Zfp185 A T X: 72,999,323 E138D possibly damaging Het
Zfp981 G A 4: 146,537,764 S382N probably benign Het
Other mutations in Fermt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Fermt2 APN 14 45464863 missense probably damaging 1.00
IGL01859:Fermt2 APN 14 45459956 missense possibly damaging 0.94
IGL02719:Fermt2 APN 14 45504656 missense probably damaging 1.00
IGL03182:Fermt2 APN 14 45461768 missense possibly damaging 0.77
ANU18:Fermt2 UTSW 14 45464863 missense probably damaging 1.00
R0107:Fermt2 UTSW 14 45464822 missense probably damaging 0.98
R0671:Fermt2 UTSW 14 45469319 missense probably benign 0.09
R1227:Fermt2 UTSW 14 45459990 missense probably benign 0.19
R1480:Fermt2 UTSW 14 45461787 missense possibly damaging 0.88
R2219:Fermt2 UTSW 14 45475897 missense probably benign
R2937:Fermt2 UTSW 14 45504491 splice site probably null
R4765:Fermt2 UTSW 14 45462236 missense probably benign 0.01
R5921:Fermt2 UTSW 14 45464746 missense probably damaging 1.00
R6063:Fermt2 UTSW 14 45459881 missense possibly damaging 0.77
R6216:Fermt2 UTSW 14 45459881 missense possibly damaging 0.77
R6254:Fermt2 UTSW 14 45476059 missense probably damaging 1.00
R6964:Fermt2 UTSW 14 45465142 missense probably damaging 0.99
R7574:Fermt2 UTSW 14 45469325 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15