Mutagenetix > Incidental Mutations

Incidental Mutation 'R1172:Nkx3-1'

99613

Institutional Source

Beutler Lab

Gene Symbol

Nkx3-1

Ensembl Gene

ENSMUSG00000022061

Gene Name

NK3 homeobox 1

Synonyms

Bax, NKX3A, NKX3.1, bagpipe, Nkx-3.1

MMRRC Submission

039245-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.337) question?

Stock #

R1172 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69190638-69194662 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69191985 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 151 (S151P)

Ref Sequence

ENSEMBL: ENSMUSP00000022646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022646]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022646
AA Change: S151P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022646
Gene: ENSMUSG00000022061
AA Change: S151P

Domain	Start	End	E-Value	Type
HOX	125	187	2.35e-23	SMART
low complexity region	207	227	N/A	INTRINSIC

Meta Mutation Damage Score

0.9302

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor. This transcription factor functions as a negative regulator of epithelial cell growth in prostate tissue. Aberrant expression of this gene is associated with prostate tumor progression. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced minor salivary glands with altered duct morphology, altered prostate ductal morphogenesis, and prostate epithelial hyperplasia and neoplasia. Heterozygotes develop neoplastic foci. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	C	A	4: 35,218,630	E76D	probably damaging	Het
Accsl	A	T	2: 93,866,244		probably benign	Het
Adam7	T	G	14: 68,514,921	K371N	probably damaging	Het
Adgrv1	A	T	13: 81,557,063	S1543T	probably damaging	Het
Agbl4	A	T	4: 111,656,318		probably benign	Het
Arid1b	T	A	17: 5,339,300	I1707N	probably damaging	Het
Atp10a	T	C	7: 58,803,766	V864A	probably benign	Het
Bivm	A	G	1: 44,126,782	T131A	probably benign	Het
Bst1	A	G	5: 43,825,408		probably null	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Ccdc28b	T	C	4: 129,620,889		probably benign	Het
Cmas	G	T	6: 142,756,878	G36C	probably benign	Het
Eml6	A	G	11: 29,749,824	S1771P	possibly damaging	Het
Epc1	A	C	18: 6,490,525	Y31D	probably damaging	Het
Fbn1	A	T	2: 125,394,687	C358S	probably benign	Het
Fbxl13	A	T	5: 21,620,604		probably benign	Het
Fermt2	T	C	14: 45,459,968	D642G	possibly damaging	Het
Fmnl2	A	T	2: 53,072,274	N257I	probably damaging	Het
Fry	G	A	5: 150,481,494	W793*	probably null	Het
Fsd2	T	C	7: 81,559,770	D108G	probably benign	Het
Glipr1l2	C	A	10: 112,083,466	L31I	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm10801	C	T	2: 98,663,907		probably benign	Het
Gm21718	T	C	14: 51,315,891		noncoding transcript	Het
Gpld1	A	G	13: 24,957,566		probably null	Het
Gtf3c2	A	T	5: 31,168,075	Y500N	probably damaging	Het
Hbs1l	A	G	10: 21,304,638	D73G	probably damaging	Het
Idh1	G	T	1: 65,161,160	N348K	probably benign	Het
Kank4	T	C	4: 98,765,569	Y874C	probably damaging	Het
Lamc2	A	T	1: 153,166,287	S34T	probably damaging	Het
Laptm4a	T	C	12: 8,936,716	V258A	probably damaging	Het
Lrrc19	A	T	4: 94,638,389	Y310*	probably null	Het
Map3k5	G	A	10: 20,056,648		probably benign	Het
Map7	G	A	10: 20,245,299	E92K	probably damaging	Het
Mettl24	G	A	10: 40,737,708	A148T	probably benign	Het
Mosmo	A	G	7: 120,730,522	Y122C	probably benign	Het
Ncr1	T	A	7: 4,338,121	I37N	probably benign	Het
Npm2	T	A	14: 70,652,221	K54*	probably null	Het
Npr1	T	A	3: 90,461,382	D457V	probably benign	Het
Nudt21	T	C	8: 94,031,129		probably benign	Het
Pcnt	A	T	10: 76,393,044		probably null	Het
Pik3r4	G	T	9: 105,663,174	G754C	probably damaging	Het
Rftn2	A	G	1: 55,211,217	V123A	probably damaging	Het
Rpa1	A	T	11: 75,312,393	V392D	probably damaging	Het
Rxfp2	T	C	5: 150,051,556	V210A	probably benign	Het
Slc45a4	C	T	15: 73,605,429		probably benign	Het
Syndig1l	T	A	12: 84,679,168		probably null	Het
Tctn1	G	A	5: 122,251,689	R257*	probably null	Het
Tenm4	A	T	7: 96,848,044	E1179V	probably damaging	Het
Txlnb	A	G	10: 17,842,756	N445S	probably benign	Het
Tyrp1	C	T	4: 80,844,868	Q331*	probably null	Het
Ubap2l	A	T	3: 90,023,500	S413T	probably benign	Het
Vdr	A	T	15: 97,869,333	Y185N	probably benign	Het
Vmn2r66	G	T	7: 85,005,591	D503E	probably benign	Het
Vmn2r72	T	A	7: 85,751,944	E89V	probably damaging	Het
Vmn2r87	T	C	10: 130,477,584	T438A	probably benign	Het
Xrcc6	A	G	15: 82,031,163	D94G	probably damaging	Het
Ywhaq	T	C	12: 21,395,023	N207S	probably benign	Het
Zfp185	A	T	X: 72,999,323	E138D	possibly damaging	Het
Zfp981	G	A	4: 146,537,764	S382N	probably benign	Het

Other mutations in Nkx3-1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0508:Nkx3-1	UTSW	14	69190901	missense	probably benign	0.00
R0606:Nkx3-1	UTSW	14	69191006	splice site	probably benign
R2024:Nkx3-1	UTSW	14	69190817	missense	probably damaging	1.00
R4889:Nkx3-1	UTSW	14	69190998	splice site	probably null
R4902:Nkx3-1	UTSW	14	69190918	missense	probably benign	0.10
R4918:Nkx3-1	UTSW	14	69190918	missense	probably benign	0.10
R4940:Nkx3-1	UTSW	14	69190918	missense	probably benign	0.10
R4963:Nkx3-1	UTSW	14	69190918	missense	probably benign	0.10
R5081:Nkx3-1	UTSW	14	69191947	missense	possibly damaging	0.64
R8472:Nkx3-1	UTSW	14	69192058	missense	probably damaging	1.00
X0064:Nkx3-1	UTSW	14	69190898	missense	possibly damaging	0.65

Predicted Primers

Posted On

2014-01-15