Incidental Mutation 'R1216:Olfr1262'
ID99622
Institutional Source Beutler Lab
Gene Symbol Olfr1262
Ensembl Gene ENSMUSG00000051313
Gene Nameolfactory receptor 1262
SynonymsGA_x6K02T2Q125-51434523-51435437, MOR234-1
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90000145-90008291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90002478 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 24 (I24N)
Ref Sequence ENSEMBL: ENSMUSP00000121666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061701] [ENSMUST00000111508] [ENSMUST00000131072] [ENSMUST00000213868]
Predicted Effect probably benign
Transcript: ENSMUST00000061701
AA Change: I24N

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052387
Gene: ENSMUSG00000051313
AA Change: I24N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 9.9e-24 PFAM
Pfam:7tm_4 134 275 1.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111508
AA Change: I24N

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107133
Gene: ENSMUSG00000051313
AA Change: I24N

DomainStartEndE-ValueType
Pfam:7tm_4 25 300 6.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 7.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131072
AA Change: I24N

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121666
Gene: ENSMUSG00000051313
AA Change: I24N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 171 1.7e-8 PFAM
Pfam:7tm_1 36 238 3.2e-22 PFAM
Pfam:7tm_4 134 240 5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213868
AA Change: I24N

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Olfr1262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1262 APN 2 90003021 missense possibly damaging 0.65
IGL03303:Olfr1262 APN 2 90002466 missense possibly damaging 0.88
R1256:Olfr1262 UTSW 2 90002567 missense possibly damaging 0.61
R1860:Olfr1262 UTSW 2 90003146 missense probably benign 0.26
R1864:Olfr1262 UTSW 2 90002481 missense probably benign 0.02
R1918:Olfr1262 UTSW 2 90002574 missense probably benign 0.12
R2192:Olfr1262 UTSW 2 90002430 missense probably damaging 0.99
R3024:Olfr1262 UTSW 2 90003240 missense probably damaging 1.00
R4155:Olfr1262 UTSW 2 90002660 missense probably benign 0.35
R4956:Olfr1262 UTSW 2 90002843 missense probably benign 0.33
R5298:Olfr1262 UTSW 2 90002460 missense possibly damaging 0.92
R5804:Olfr1262 UTSW 2 90002988 missense possibly damaging 0.91
R6766:Olfr1262 UTSW 2 90002532 missense probably benign 0.06
R7674:Olfr1262 UTSW 2 90003045 missense probably damaging 0.99
Z1176:Olfr1262 UTSW 2 90003048 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAGCAGTGCAGCTATGTTCACC -3'
(R):5'- GCTGAGTCATGCAGCCATTGAAGG -3'

Sequencing Primer
(F):5'- TATGTTCACCTCAGGGACCAG -3'
(R):5'- GCTCTTCTCAGAGATTAGGTCATAG -3'
Posted On2014-01-15