Mutagenetix > Incidental Mutations

Incidental Mutation 'R1216:Tecta'

99649

Institutional Source

Beutler Lab

Gene Symbol

Tecta

Ensembl Gene

ENSMUSG00000037705

Gene Name

tectorin alpha

Synonyms

[a]-tectorin, Tctna

MMRRC Submission

039285-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R1216 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42329619-42399929 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 42377907 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 454 (I454K)

Ref Sequence

ENSEMBL: ENSMUSP00000125370 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]

Predicted Effect

probably benign
Transcript: ENSMUST00000042190
AA Change: I454K

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: I454K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	9.8e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1684	1758	6.51e-10	SMART
ZP	1805	2059	2.95e-85	SMART
EGF	2087	2122	2.07e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160940
AA Change: I454K

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: I454K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	6.1e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1679	1753	6.51e-10	SMART
ZP	1800	2054	2.95e-85	SMART
EGF	2082	2117	2.07e1	SMART

Meta Mutation Damage Score

0.1397

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.3%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,798,492	D332V	probably damaging	Het
Akr1c12	T	C	13: 4,276,323	Y53C	probably benign	Het
Arhgap23	T	C	11: 97,492,672		probably benign	Het
AU040320	T	C	4: 126,816,483		probably benign	Het
B4galnt2	A	G	11: 95,891,941	L15P	probably benign	Het
Cadps2	A	G	6: 23,583,473		probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Dppa4	T	C	16: 48,292,980	F244S	possibly damaging	Het
Exoc1	A	G	5: 76,554,188	K445R	probably benign	Het
Fam47e	A	G	5: 92,562,484	E114G	probably damaging	Het
Fgf12	A	T	16: 28,162,450	N171K	possibly damaging	Het
Fyb2	G	A	4: 104,995,706	V528M	possibly damaging	Het
Ghr	A	G	15: 3,319,855	S614P	probably damaging	Het
Gm10985	A	C	3: 53,845,253	Y19S	probably damaging	Het
Gpr152	T	A	19: 4,143,555	V365D	possibly damaging	Het
Guca1a	A	G	17: 47,395,712		probably benign	Het
Hivep1	G	A	13: 42,157,521	G1079D	probably benign	Het
Hnrnpm	T	C	17: 33,649,713	D580G	probably damaging	Het
Ints6	A	T	14: 62,707,698	D394E	probably damaging	Het
Kat6b	T	A	14: 21,622,040	Y339*	probably null	Het
Kcnj11	C	A	7: 46,099,861	V13L	probably benign	Het
Lama3	C	T	18: 12,421,134		probably benign	Het
Myo18a	A	G	11: 77,818,647	T161A	probably benign	Het
Ncapg	G	T	5: 45,699,919	S991I	possibly damaging	Het
Nrde2	G	A	12: 100,149,810		probably benign	Het
Olfr1262	T	A	2: 90,002,478	I24N	probably benign	Het
Olfr73	T	C	2: 88,034,258	R294G	probably damaging	Het
Pcdhb7	A	T	18: 37,343,874	T688S	probably damaging	Het
Pla2g6	T	C	15: 79,306,435	D309G	probably benign	Het
Plod1	A	T	4: 147,921,127	V404D	probably damaging	Het
Ppp2r2a	G	T	14: 67,028,998	Y71*	probably null	Het
Prcp	A	G	7: 92,917,746	N222S	probably benign	Het
Rad21	T	C	15: 51,970,136	T316A	possibly damaging	Het
Ranbp2	T	C	10: 58,483,212		probably benign	Het
Rapgef4	C	A	2: 72,208,148	P548T	possibly damaging	Het
Ric1	G	T	19: 29,577,735	M416I	probably benign	Het
Skiv2l2	A	G	13: 112,914,342		probably benign	Het
Slc9a8	T	C	2: 167,424,121	F6S	probably benign	Het
Smpdl3a	T	G	10: 57,802,479	I126S	probably null	Het
Sphkap	A	T	1: 83,290,977	L98Q	probably damaging	Het
Spink4	T	G	4: 40,924,974		probably benign	Het
Taar5	A	T	10: 23,971,707	L334F	probably damaging	Het
Ttc7	C	T	17: 87,346,578	T561M	possibly damaging	Het
Vmn2r9	G	T	5: 108,847,574	H403N	probably damaging	Het
Zdbf2	G	A	1: 63,303,002	C180Y	possibly damaging	Het

Other mutations in Tecta

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Tecta	APN	9	42332548	missense	probably damaging	1.00
IGL00925:Tecta	APN	9	42375035	missense	probably benign
IGL00960:Tecta	APN	9	42359080	missense	possibly damaging	0.74
IGL00974:Tecta	APN	9	42331374	missense	probably benign	0.00
IGL01070:Tecta	APN	9	42395003	missense	probably damaging	1.00
IGL01284:Tecta	APN	9	42345620	missense	probably damaging	1.00
IGL01324:Tecta	APN	9	42345431	missense	probably damaging	1.00
IGL01694:Tecta	APN	9	42367179	missense	possibly damaging	0.92
IGL01861:Tecta	APN	9	42373362	missense	probably benign
IGL02010:Tecta	APN	9	42337193	missense	probably damaging	0.97
IGL02397:Tecta	APN	9	42394998	missense	probably damaging	1.00
IGL03031:Tecta	APN	9	42345493	missense	probably benign
IGL03208:Tecta	APN	9	42337100	splice site	probably benign
IGL03249:Tecta	APN	9	42391886	missense	probably benign	0.20
R0004:Tecta	UTSW	9	42345478	missense	possibly damaging	0.74
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0119:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0133:Tecta	UTSW	9	42367228	missense	probably benign	0.00
R0157:Tecta	UTSW	9	42375011	missense	probably benign
R0180:Tecta	UTSW	9	42366813	missense	probably benign
R0299:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0345:Tecta	UTSW	9	42384218	missense	probably damaging	0.98
R0370:Tecta	UTSW	9	42366804	missense	probably benign
R0465:Tecta	UTSW	9	42359418	missense	possibly damaging	0.62
R0466:Tecta	UTSW	9	42373073	missense	probably benign
R0479:Tecta	UTSW	9	42337939	missense	probably damaging	1.00
R0498:Tecta	UTSW	9	42377614	missense	probably damaging	1.00
R0499:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0519:Tecta	UTSW	9	42347892	splice site	probably benign
R0584:Tecta	UTSW	9	42347908	missense	possibly damaging	0.79
R0589:Tecta	UTSW	9	42345634	missense	probably benign	0.01
R0607:Tecta	UTSW	9	42388205	missense	probably damaging	1.00
R0691:Tecta	UTSW	9	42384341	missense	probably damaging	1.00
R0905:Tecta	UTSW	9	42338994	missense	probably damaging	1.00
R1239:Tecta	UTSW	9	42332485	missense	probably damaging	1.00
R1442:Tecta	UTSW	9	42332482	missense	probably damaging	1.00
R1553:Tecta	UTSW	9	42348186	missense	probably damaging	1.00
R1727:Tecta	UTSW	9	42359301	missense	probably damaging	0.96
R1728:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1729:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1762:Tecta	UTSW	9	42375309	missense	probably benign	0.30
R1778:Tecta	UTSW	9	42343631	missense	probably damaging	1.00
R1795:Tecta	UTSW	9	42378049	missense	probably benign
R1796:Tecta	UTSW	9	42384197	missense	probably damaging	1.00
R1866:Tecta	UTSW	9	42392024	missense	probably damaging	0.97
R1871:Tecta	UTSW	9	42337176	missense	probably damaging	0.98
R1871:Tecta	UTSW	9	42337340	missense	probably damaging	1.00
R1911:Tecta	UTSW	9	42337936	missense	probably damaging	1.00
R2074:Tecta	UTSW	9	42337279	nonsense	probably null
R2135:Tecta	UTSW	9	42340285	missense	probably damaging	1.00
R2171:Tecta	UTSW	9	42358924	missense	probably damaging	0.99
R2220:Tecta	UTSW	9	42392030	missense	probably damaging	1.00
R2372:Tecta	UTSW	9	42388274	missense	probably damaging	1.00
R2570:Tecta	UTSW	9	42332552	missense	probably damaging	1.00
R2939:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R2940:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3081:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3407:Tecta	UTSW	9	42337854	missense	probably damaging	1.00
R3732:Tecta	UTSW	9	42392106	missense	possibly damaging	0.95
R3771:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3772:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3773:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3832:Tecta	UTSW	9	42339033	missense	probably damaging	1.00
R4378:Tecta	UTSW	9	42366708	missense	probably damaging	1.00
R4480:Tecta	UTSW	9	42373233	missense	possibly damaging	0.75
R4485:Tecta	UTSW	9	42337274	missense	possibly damaging	0.73
R4804:Tecta	UTSW	9	42398237	missense	probably benign
R4869:Tecta	UTSW	9	42375534	missense	probably benign	0.02
R4944:Tecta	UTSW	9	42330277	missense	probably benign	0.05
R5008:Tecta	UTSW	9	42373062	missense	possibly damaging	0.76
R5014:Tecta	UTSW	9	42373242	missense	probably damaging	1.00
R5125:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5178:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5180:Tecta	UTSW	9	42337208	missense	probably damaging	1.00
R5214:Tecta	UTSW	9	42345668	missense	probably benign	0.04
R5230:Tecta	UTSW	9	42394943	missense	probably damaging	0.96
R5330:Tecta	UTSW	9	42337856	missense	probably damaging	1.00
R5387:Tecta	UTSW	9	42375063	missense	probably damaging	0.98
R5614:Tecta	UTSW	9	42339055	missense	probably damaging	1.00
R5708:Tecta	UTSW	9	42338926	missense	probably damaging	1.00
R5738:Tecta	UTSW	9	42373178	missense	possibly damaging	0.63
R5770:Tecta	UTSW	9	42345589	missense	possibly damaging	0.94
R5839:Tecta	UTSW	9	42331023	missense	probably benign	0.03
R5839:Tecta	UTSW	9	42372976	missense	possibly damaging	0.86
R6119:Tecta	UTSW	9	42373075	missense	probably benign	0.00
R6246:Tecta	UTSW	9	42377908	missense	probably benign	0.07
R6377:Tecta	UTSW	9	42343755	missense	probably damaging	1.00
R6416:Tecta	UTSW	9	42375267	missense	probably damaging	0.97
R6595:Tecta	UTSW	9	42384227	missense	probably damaging	1.00
R6850:Tecta	UTSW	9	42343838	missense	probably benign	0.20
R6859:Tecta	UTSW	9	42392129	missense	probably damaging	1.00
R6861:Tecta	UTSW	9	42337337	missense	possibly damaging	0.93
R6939:Tecta	UTSW	9	42347997	missense	probably damaging	1.00
R6996:Tecta	UTSW	9	42366786	missense	probably benign
R7069:Tecta	UTSW	9	42394941	missense	probably benign	0.03
R7104:Tecta	UTSW	9	42366943	missense	probably benign	0.00
R7129:Tecta	UTSW	9	42347991	missense	probably damaging	1.00
R7220:Tecta	UTSW	9	42343887	missense	probably benign	0.05
R7251:Tecta	UTSW	9	42387752	missense	probably damaging	1.00
R7307:Tecta	UTSW	9	42377992	missense	probably damaging	1.00
R7343:Tecta	UTSW	9	42337332	missense	probably damaging	1.00
R7355:Tecta	UTSW	9	42367142	nonsense	probably null
R7635:Tecta	UTSW	9	42330987	missense	probably benign	0.11
R7653:Tecta	UTSW	9	42337236	missense	probably damaging	1.00
R7723:Tecta	UTSW	9	42366936	missense	probably damaging	1.00
R7939:Tecta	UTSW	9	42388223	missense	probably damaging	0.99
R7966:Tecta	UTSW	9	42394962	missense	probably damaging	0.98
R7967:Tecta	UTSW	9	42377955	missense	possibly damaging	0.95
R8000:Tecta	UTSW	9	42367184	nonsense	probably null
R8064:Tecta	UTSW	9	42394955	missense	possibly damaging	0.94
R8117:Tecta	UTSW	9	42377631	missense	probably damaging	1.00
R8176:Tecta	UTSW	9	42359169	missense	probably damaging	0.97
R8284:Tecta	UTSW	9	42378029	missense	possibly damaging	0.89
R8315:Tecta	UTSW	9	42387825	critical splice acceptor site	probably null
R8321:Tecta	UTSW	9	42373053	missense	probably damaging	1.00
R8332:Tecta	UTSW	9	42375014	missense	probably damaging	1.00
R8437:Tecta	UTSW	9	42332560	missense	probably damaging	0.98
R8496:Tecta	UTSW	9	42330251	missense	probably benign	0.01
R8514:Tecta	UTSW	9	42373110	missense	probably damaging	0.99
Z1176:Tecta	UTSW	9	42392094	missense	probably damaging	0.99
Z1177:Tecta	UTSW	9	42375576	missense	probably benign	0.00
Z1177:Tecta	UTSW	9	42392070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCGCAGTAGTCAGAACCAAAGTAG -3'
(R):5'- TGAAAACTCGGGGTGACCACTCTC -3'

Sequencing Primer
(F):5'- CCAAAGTAGAGGGCCTCAGTG -3'
(R):5'- GGGTGACCACTCTCTCCTAAATAG -3'

Posted On

2014-01-15