Incidental Mutation 'R1216:B4galnt2'
ID 99659
Institutional Source Beutler Lab
Gene Symbol B4galnt2
Ensembl Gene ENSMUSG00000013418
Gene Name beta-1,4-N-acetyl-galactosaminyl transferase 2
Synonyms Galgt2, Dlb-1, Dlb1
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R1216 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 95865943-95914891 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95891941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 15 (L15P)
Ref Sequence ENSEMBL: ENSMUSP00000037239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038343]
AlphaFold Q09199
Predicted Effect probably benign
Transcript: ENSMUST00000038343
AA Change: L15P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000037239
Gene: ENSMUSG00000013418
AA Change: L15P

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
Pfam:Glycos_transf_2 268 433 1.3e-19 PFAM
Meta Mutation Damage Score 0.1415 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT2 catalyzes the last step in the biosynthesis of the human Sd(a) antigen through the addition of an N-acetylgalactosamine residue via a beta-1,4 linkage to a subterminal galactose residue substituted with an alpha-2,3-linked sialic acid. B4GALNT2 also catalyzes the last step in the biosynthesis of the Cad antigen (Montiel et al., 2003 [PubMed 12678917]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele show increased startle reflex, increased systemic arterial diastolic blood pressure, abnormal B cell number, increased neutrophil cell number, and increased circulating alkaline phosphatase level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in B4galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03252:B4galnt2 APN 11 95873931 missense probably damaging 0.99
R0594:B4galnt2 UTSW 11 95891909 missense probably benign 0.00
R1344:B4galnt2 UTSW 11 95869355 missense probably benign 0.43
R1735:B4galnt2 UTSW 11 95890983 missense probably damaging 0.99
R4706:B4galnt2 UTSW 11 95876097 critical splice donor site probably null
R4707:B4galnt2 UTSW 11 95876097 critical splice donor site probably null
R4867:B4galnt2 UTSW 11 95868426 missense probably damaging 1.00
R4937:B4galnt2 UTSW 11 95868429 missense probably damaging 1.00
R4967:B4galnt2 UTSW 11 95869274 missense probably benign 0.19
R5077:B4galnt2 UTSW 11 95876314 intron probably benign
R5822:B4galnt2 UTSW 11 95866159 missense probably damaging 1.00
R6225:B4galnt2 UTSW 11 95868442 missense probably damaging 1.00
R6239:B4galnt2 UTSW 11 95876239 missense probably damaging 0.99
R6653:B4galnt2 UTSW 11 95891921 missense probably benign
R6747:B4galnt2 UTSW 11 95868634 splice site probably null
R6969:B4galnt2 UTSW 11 95891930 missense probably benign 0.02
R7448:B4galnt2 UTSW 11 95869367 missense probably damaging 1.00
R7879:B4galnt2 UTSW 11 95869397 missense possibly damaging 0.87
R8372:B4galnt2 UTSW 11 95869280 missense possibly damaging 0.61
R8397:B4galnt2 UTSW 11 95866163 missense probably benign 0.00
R8966:B4galnt2 UTSW 11 95890985 missense probably damaging 1.00
X0009:B4galnt2 UTSW 11 95891061 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTCCCAGTGAAGTTGCAAGGTTACC -3'
(R):5'- TTTACGTGGTTGCAGGAGACTGCAC -3'

Sequencing Primer
(F):5'- GTCTACGATGTCTAAGGCTCAAG -3'
(R):5'- gcaggagactgcactcagg -3'
Posted On 2014-01-15