Mutagenetix > Incidental Mutations

Incidental Mutation 'R1216:Ric1'

99699

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

039285-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.528) question?

Stock #

R1216 (G1)

Quality Score

167

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 29577735 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 416 (M416I)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

probably benign
Transcript: ENSMUST00000043610
AA Change: M416I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: M416I

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160221

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: M344I

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: M344I

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.1052

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.3%

Validation Efficiency

98% (45/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,798,492	D332V	probably damaging	Het
Akr1c12	T	C	13: 4,276,323	Y53C	probably benign	Het
Arhgap23	T	C	11: 97,492,672		probably benign	Het
AU040320	T	C	4: 126,816,483		probably benign	Het
B4galnt2	A	G	11: 95,891,941	L15P	probably benign	Het
Cadps2	A	G	6: 23,583,473		probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Dppa4	T	C	16: 48,292,980	F244S	possibly damaging	Het
Exoc1	A	G	5: 76,554,188	K445R	probably benign	Het
Fam47e	A	G	5: 92,562,484	E114G	probably damaging	Het
Fgf12	A	T	16: 28,162,450	N171K	possibly damaging	Het
Fyb2	G	A	4: 104,995,706	V528M	possibly damaging	Het
Ghr	A	G	15: 3,319,855	S614P	probably damaging	Het
Gm10985	A	C	3: 53,845,253	Y19S	probably damaging	Het
Gpr152	T	A	19: 4,143,555	V365D	possibly damaging	Het
Guca1a	A	G	17: 47,395,712		probably benign	Het
Hivep1	G	A	13: 42,157,521	G1079D	probably benign	Het
Hnrnpm	T	C	17: 33,649,713	D580G	probably damaging	Het
Ints6	A	T	14: 62,707,698	D394E	probably damaging	Het
Kat6b	T	A	14: 21,622,040	Y339*	probably null	Het
Kcnj11	C	A	7: 46,099,861	V13L	probably benign	Het
Lama3	C	T	18: 12,421,134		probably benign	Het
Myo18a	A	G	11: 77,818,647	T161A	probably benign	Het
Ncapg	G	T	5: 45,699,919	S991I	possibly damaging	Het
Nrde2	G	A	12: 100,149,810		probably benign	Het
Olfr1262	T	A	2: 90,002,478	I24N	probably benign	Het
Olfr73	T	C	2: 88,034,258	R294G	probably damaging	Het
Pcdhb7	A	T	18: 37,343,874	T688S	probably damaging	Het
Pla2g6	T	C	15: 79,306,435	D309G	probably benign	Het
Plod1	A	T	4: 147,921,127	V404D	probably damaging	Het
Ppp2r2a	G	T	14: 67,028,998	Y71*	probably null	Het
Prcp	A	G	7: 92,917,746	N222S	probably benign	Het
Rad21	T	C	15: 51,970,136	T316A	possibly damaging	Het
Ranbp2	T	C	10: 58,483,212		probably benign	Het
Rapgef4	C	A	2: 72,208,148	P548T	possibly damaging	Het
Skiv2l2	A	G	13: 112,914,342		probably benign	Het
Slc9a8	T	C	2: 167,424,121	F6S	probably benign	Het
Smpdl3a	T	G	10: 57,802,479	I126S	probably null	Het
Sphkap	A	T	1: 83,290,977	L98Q	probably damaging	Het
Spink4	T	G	4: 40,924,974		probably benign	Het
Taar5	A	T	10: 23,971,707	L334F	probably damaging	Het
Tecta	A	T	9: 42,377,907	I454K	probably benign	Het
Ttc7	C	T	17: 87,346,578	T561M	possibly damaging	Het
Vmn2r9	G	T	5: 108,847,574	H403N	probably damaging	Het
Zdbf2	G	A	1: 63,303,002	C180Y	possibly damaging	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7933:Ric1	UTSW	19	29594893	missense	probably benign
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGGGGTGCAGAAGGCTAT -3'
(R):5'- AGTGCCTGTATGAGAGTGTGAAGTGA -3'

Sequencing Primer
(F):5'- GTGCAGAAGGCTATCACTTATG -3'
(R):5'- cttagccatctctccagcc -3'

Posted On

2014-01-15