Incidental Mutation 'R1217:Dhx9'
ID99711
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonymsleukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1217 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153455758-153487660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153458363 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1017 (T1017I)
Ref Sequence ENSEMBL: ENSMUSP00000038135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966]
Predicted Effect probably damaging
Transcript: ENSMUST00000042141
AA Change: T1017I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: T1017I

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186380
AA Change: T1016I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: T1016I

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Meta Mutation Damage Score 0.4964 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153465748 missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153464898 missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153459566 missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153468868 splice site probably benign
IGL02938:Dhx9 APN 1 153464630 missense probably benign 0.37
R0001:Dhx9 UTSW 1 153462636 missense probably damaging 1.00
R0046:Dhx9 UTSW 1 153472707 missense probably benign 0.27
R0309:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R0517:Dhx9 UTSW 1 153478916 missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153472291 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R1456:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R1460:Dhx9 UTSW 1 153465680 missense probably benign 0.01
R1724:Dhx9 UTSW 1 153458488 missense probably benign 0.00
R1848:Dhx9 UTSW 1 153465753 missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153460274 splice site probably null
R2001:Dhx9 UTSW 1 153456111 nonsense probably null
R3084:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3085:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3123:Dhx9 UTSW 1 153465706 missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153478120 missense probably benign 0.16
R4274:Dhx9 UTSW 1 153468926 missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153471789 missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153467157 missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153460303 missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153467051 frame shift probably null
R4603:Dhx9 UTSW 1 153467051 frame shift probably null
R4889:Dhx9 UTSW 1 153481149 missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153472673 missense probably benign 0.02
R5411:Dhx9 UTSW 1 153481223 missense probably benign 0.27
R5569:Dhx9 UTSW 1 153467092 missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R5659:Dhx9 UTSW 1 153471735 missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153478089 missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153472463 missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153456578 unclassified probably benign
R6489:Dhx9 UTSW 1 153456643 unclassified probably benign
R6717:Dhx9 UTSW 1 153473464 intron probably null
R7098:Dhx9 UTSW 1 153465022 missense probably benign
R7209:Dhx9 UTSW 1 153464623 missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153465677 missense probably benign 0.00
R7440:Dhx9 UTSW 1 153481231 missense probably benign
R7685:Dhx9 UTSW 1 153458406 missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153465001 missense probably benign 0.07
X0066:Dhx9 UTSW 1 153472529 missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153456575 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTCACTAAGGTCATGCCTTTAGC -3'
(R):5'- TGTCAGAGGGCTTAGAGAGTCATGC -3'

Sequencing Primer
(F):5'- ATGCCTTTAGCAGAGATGGCTC -3'
(R):5'- CACAAGTGTTTACTAACACTGGACC -3'
Posted On2014-01-15