Incidental Mutation 'R1217:Lmx1a'
ID99713
Institutional Source Beutler Lab
Gene Symbol Lmx1a
Ensembl Gene ENSMUSG00000026686
Gene NameLIM homeobox transcription factor 1 alpha
Synonymsshaker short-tail, Lmx1.1
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R1217 (G1)
Quality Score124
Status Validated
Chromosome1
Chromosomal Location167689237-167848741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 167791399 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 109 (R109H)
Ref Sequence ENSEMBL: ENSMUSP00000107008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028003] [ENSMUST00000111377]
Predicted Effect probably damaging
Transcript: ENSMUST00000028003
AA Change: R109H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028003
Gene: ENSMUSG00000026686
AA Change: R109H

DomainStartEndE-ValueType
LIM 34 85 2.87e-15 SMART
LIM 93 147 3.39e-17 SMART
HOX 195 257 2.62e-21 SMART
low complexity region 337 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111377
AA Change: R109H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107008
Gene: ENSMUSG00000026686
AA Change: R109H

DomainStartEndE-ValueType
LIM 34 85 2.87e-15 SMART
LIM 93 147 3.39e-17 SMART
HOX 195 257 2.62e-21 SMART
low complexity region 337 350 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeodomain and LIM-domain containing protein. The encoded protein is a transcription factor that acts as a positive regulator of insulin gene transcription. This gene also plays a role in the development of dopamine producing neurons during embryogenesis. Mutations in this gene are associated with an increased risk of developing Parkinson's disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mutations in the dreher locus produce neurological and skeletal abnormalities, inner ear defects, and belly spotting. Deafness and hypoplasia of Mullerian duct derivatives are also reported for some alleles. Homozygous null mice have fewer dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Lmx1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02624:Lmx1a APN 1 167844623 splice site probably benign
IGL02629:Lmx1a APN 1 167844623 splice site probably benign
IGL02637:Lmx1a APN 1 167844623 splice site probably benign
IGL02642:Lmx1a APN 1 167844623 splice site probably benign
IGL02811:Lmx1a APN 1 167791374 missense probably benign 0.06
scooby UTSW 1 167830687 missense possibly damaging 0.47
R0320:Lmx1a UTSW 1 167791404 nonsense probably null
R2897:Lmx1a UTSW 1 167830540 splice site probably benign
R4211:Lmx1a UTSW 1 167832859 missense probably damaging 0.96
R4976:Lmx1a UTSW 1 167791554 missense possibly damaging 0.73
R5125:Lmx1a UTSW 1 167830687 missense possibly damaging 0.47
R6858:Lmx1a UTSW 1 167832881 missense probably damaging 1.00
R7099:Lmx1a UTSW 1 167830546 missense probably damaging 1.00
R7177:Lmx1a UTSW 1 167846678 missense probably benign
R7380:Lmx1a UTSW 1 167692040 missense probably damaging 1.00
R7831:Lmx1a UTSW 1 167840952 missense probably benign 0.06
R7914:Lmx1a UTSW 1 167840952 missense probably benign 0.06
Z1176:Lmx1a UTSW 1 167691999 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCACCAGTACAAACATTCCTGTCC -3'
(R):5'- GCAGAGAATTGCCTTGCCATAGACC -3'

Sequencing Primer
(F):5'- CATTCCTGTCCCAGGGTTGAAG -3'
(R):5'- AAGGCACTCACCTGAGTCTG -3'
Posted On2014-01-15