Incidental Mutation 'R1217:Myo3b'
ID 99715
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1217 (G1)
Quality Score 149
Status Validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 70330880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1128 (E1128A)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: E1156A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: E1156A

S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: E1128A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: E1128A

S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
R9251:Myo3b UTSW 2 70258081 nonsense probably null
R9268:Myo3b UTSW 2 70426961 makesense probably null
R9334:Myo3b UTSW 2 70217016 missense probably damaging 1.00
R9377:Myo3b UTSW 2 70238898 missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70095209 missense probably benign 0.01
R9520:Myo3b UTSW 2 70232409 missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70245304 missense probably benign 0.43
R9671:Myo3b UTSW 2 70256564 missense probably damaging 1.00
R9790:Myo3b UTSW 2 70349943 missense probably benign 0.35
R9791:Myo3b UTSW 2 70349943 missense probably benign 0.35
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- caacaatggagtcaaagtcaaaag -3'
Posted On 2014-01-15