Incidental Mutation 'R1217:Rimbp2'
ID99730
Institutional Source Beutler Lab
Gene Symbol Rimbp2
Ensembl Gene ENSMUSG00000029420
Gene NameRIMS binding protein 2
Synonyms
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1217 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location128757791-128953486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128788287 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 666 (A666T)
Ref Sequence ENSEMBL: ENSMUSP00000143725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111346] [ENSMUST00000196085] [ENSMUST00000198941] [ENSMUST00000199537] [ENSMUST00000200470]
Predicted Effect probably benign
Transcript: ENSMUST00000111346
AA Change: A666T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106978
Gene: ENSMUSG00000029420
AA Change: A666T

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196085
AA Change: A666T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143725
Gene: ENSMUSG00000029420
AA Change: A666T

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1e-13 SMART
FN3 318 398 7.7e-4 SMART
FN3 412 484 1.7e-5 SMART
FN3 508 594 1.6e-4 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 699 720 N/A INTRINSIC
low complexity region 751 767 N/A INTRINSIC
SH3 803 867 3.2e-13 SMART
SH3 907 970 4.5e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198941
AA Change: A666T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142455
Gene: ENSMUSG00000029420
AA Change: A666T

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199537
AA Change: A659T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143276
Gene: ENSMUSG00000029420
AA Change: A659T

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 1.61e-11 SMART
FN3 311 391 1.52e-1 SMART
FN3 405 477 3.59e-3 SMART
FN3 501 587 3.08e-2 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 5.24e-11 SMART
SH3 975 1038 7.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200470
AA Change: A659T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143099
Gene: ENSMUSG00000029420
AA Change: A659T

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 9.8e-14 SMART
FN3 311 391 7.5e-4 SMART
FN3 405 477 1.7e-5 SMART
FN3 501 587 1.5e-4 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 3.2e-13 SMART
SH3 975 1038 4.4e-20 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous knockout results in a mild neurological phenotype with changes in the synaptic transmission and plasticity of hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Rimbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Rimbp2 APN 5 128806441 missense probably benign 0.00
IGL01321:Rimbp2 APN 5 128786752 missense probably benign 0.10
IGL01459:Rimbp2 APN 5 128788211 critical splice donor site probably null
IGL01743:Rimbp2 APN 5 128797848 splice site probably benign
IGL01975:Rimbp2 APN 5 128797648 missense probably benign 0.30
IGL02269:Rimbp2 APN 5 128774295 missense probably damaging 1.00
IGL02341:Rimbp2 APN 5 128800961 nonsense probably null
IGL02368:Rimbp2 APN 5 128788154 splice site probably null
IGL02392:Rimbp2 APN 5 128771797 missense probably benign 0.01
IGL03156:Rimbp2 APN 5 128771757 missense probably damaging 1.00
IGL02837:Rimbp2 UTSW 5 128797745 missense probably damaging 0.98
PIT4418001:Rimbp2 UTSW 5 128780361 missense probably benign 0.00
R0193:Rimbp2 UTSW 5 128788356 missense probably benign 0.12
R0376:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0377:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0661:Rimbp2 UTSW 5 128786710 missense probably benign 0.20
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1551:Rimbp2 UTSW 5 128806359 missense probably damaging 0.97
R1883:Rimbp2 UTSW 5 128803934 missense possibly damaging 0.93
R1970:Rimbp2 UTSW 5 128797241 missense probably damaging 1.00
R2111:Rimbp2 UTSW 5 128773501 missense probably damaging 1.00
R2120:Rimbp2 UTSW 5 128788518 missense probably damaging 1.00
R2155:Rimbp2 UTSW 5 128788165 missense probably damaging 0.99
R2332:Rimbp2 UTSW 5 128789641 missense probably benign 0.42
R2370:Rimbp2 UTSW 5 128803844 missense probably damaging 0.99
R2402:Rimbp2 UTSW 5 128784888 missense probably damaging 1.00
R3710:Rimbp2 UTSW 5 128789731 missense probably benign 0.16
R3877:Rimbp2 UTSW 5 128773465 missense probably damaging 1.00
R3974:Rimbp2 UTSW 5 128797798 missense probably damaging 1.00
R4257:Rimbp2 UTSW 5 128774260 missense probably damaging 1.00
R4270:Rimbp2 UTSW 5 128819777 missense probably benign
R4271:Rimbp2 UTSW 5 128819777 missense probably benign
R4281:Rimbp2 UTSW 5 128788340 missense possibly damaging 0.82
R4934:Rimbp2 UTSW 5 128788515 missense probably benign 0.12
R5011:Rimbp2 UTSW 5 128803921 missense probably damaging 0.98
R5173:Rimbp2 UTSW 5 128797648 missense probably benign 0.30
R5288:Rimbp2 UTSW 5 128788592 missense probably benign 0.00
R5305:Rimbp2 UTSW 5 128797381 missense possibly damaging 0.69
R5554:Rimbp2 UTSW 5 128780342 missense probably damaging 0.98
R6189:Rimbp2 UTSW 5 128803897 missense probably benign
R7023:Rimbp2 UTSW 5 128802783 critical splice donor site probably null
R7096:Rimbp2 UTSW 5 128774269 missense probably damaging 0.99
R7451:Rimbp2 UTSW 5 128788371 missense probably benign 0.00
R7789:Rimbp2 UTSW 5 128774335 missense probably damaging 0.99
R7793:Rimbp2 UTSW 5 128789695 missense possibly damaging 0.92
R7894:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
R7977:Rimbp2 UTSW 5 128761464 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128761339 missense probably benign 0.07
Z1177:Rimbp2 UTSW 5 128773451 missense probably benign 0.01
Z1177:Rimbp2 UTSW 5 128788180 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128797607 missense probably damaging 1.00
Z1177:Rimbp2 UTSW 5 128797631 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCCACGATGGGAATATGCCCAAATC -3'
(R):5'- TATGACATGCCGACAGCCTGTGAC -3'

Sequencing Primer
(F):5'- CACATAGCCTTAGGCTGGGATG -3'
(R):5'- AGCCTGTGACATGGCTTTC -3'
Posted On2014-01-15