Incidental Mutation 'R1217:Cyth3'
ID99731
Institutional Source Beutler Lab
Gene Symbol Cyth3
Ensembl Gene ENSMUSG00000018001
Gene Namecytohesin 3
SynonymsGrp1, Pscd3, cytohesin 3
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R1217 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143622447-143710250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143702820 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 240 (Y240H)
Ref Sequence ENSEMBL: ENSMUSP00000112157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110727] [ENSMUST00000116456]
PDB Structure
GRP1 PH DOMAIN WITH INS(1,3,4,5)P4 [X-RAY DIFFRACTION]
GRP1 PH DOMAIN (UNLIGANDED) [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol(1,3,4,5,6)pentakisphosphate [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol 1,3,4,5-tetrakisphosphate [X-RAY DIFFRACTION]
Triglycine variant of the Grp1 Pleckstrin Homology Domain unliganded [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000110727
AA Change: Y192H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106355
Gene: ENSMUSG00000018001
AA Change: Y192H

DomainStartEndE-ValueType
Sec7 15 200 1.5e-106 SMART
PH 217 334 1.1e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116456
AA Change: Y240H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001
AA Change: Y240H

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Meta Mutation Damage Score 0.6425 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. PSCD family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This encoded protein is involved in the control of Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation factor protein 6 (ARF) functions, in addition to acting on ARF1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Cyth3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyth3 APN 5 143707165 splice site probably null
IGL01340:Cyth3 APN 5 143684435 nonsense probably null
IGL01372:Cyth3 APN 5 143692638 missense possibly damaging 0.93
IGL02092:Cyth3 APN 5 143707385 splice site probably benign
IGL02850:Cyth3 APN 5 143686504 missense probably damaging 0.97
IGL02892:Cyth3 APN 5 143707437 missense possibly damaging 0.86
R0373:Cyth3 UTSW 5 143684426 utr 5 prime probably benign
R0726:Cyth3 UTSW 5 143692642 missense probably benign 0.00
R1552:Cyth3 UTSW 5 143697750 missense probably benign 0.12
R1623:Cyth3 UTSW 5 143701372 missense probably damaging 1.00
R1873:Cyth3 UTSW 5 143697761 missense possibly damaging 0.54
R3788:Cyth3 UTSW 5 143636543 intron probably benign
R4736:Cyth3 UTSW 5 143684479 critical splice donor site probably null
R6500:Cyth3 UTSW 5 143707840 missense probably damaging 0.97
R6824:Cyth3 UTSW 5 143686510 missense probably damaging 1.00
R7105:Cyth3 UTSW 5 143707272 missense probably benign 0.07
R7143:Cyth3 UTSW 5 143684396 missense unknown
R7767:Cyth3 UTSW 5 143707474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGGGTTTCCCTACTGTGTGT -3'
(R):5'- TGACCCACTCTGGAAGGCCAC -3'

Sequencing Primer
(F):5'- tccccctgtgtctgtctc -3'
(R):5'- GCTCTGGCTTGACTGCAC -3'
Posted On2014-01-15