Incidental Mutation 'R1217:Ccp110'
ID99743
Institutional Source Beutler Lab
Gene Symbol Ccp110
Ensembl Gene ENSMUSG00000033904
Gene Namecentriolar coiled coil protein 110
Synonyms6330503K22Rik, CP110
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R1217 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118712552-118737024 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 118729944 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000038650] [ENSMUST00000106557]
Predicted Effect probably benign
Transcript: ENSMUST00000038650
SMART Domains Protein: ENSMUSP00000038881
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
Pfam:CALM_bind 29 135 7.4e-21 PFAM
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106557
SMART Domains Protein: ENSMUSP00000102167
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149056
Predicted Effect probably benign
Transcript: ENSMUST00000208766
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pleiotropic phenotypes due to impaired sonic hedgehog (Shh) signaling and failure of primary cilia formation in multiple tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Ccp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ccp110 APN 7 118722424 missense possibly damaging 0.79
IGL00481:Ccp110 APN 7 118729997 missense possibly damaging 0.70
IGL00725:Ccp110 APN 7 118730723 missense probably damaging 0.99
IGL00899:Ccp110 APN 7 118722684 missense probably benign
IGL01837:Ccp110 APN 7 118725461 critical splice donor site probably null
PIT4469001:Ccp110 UTSW 7 118722377 missense probably benign 0.06
R1640:Ccp110 UTSW 7 118715528 splice site probably null
R1700:Ccp110 UTSW 7 118735313 missense probably damaging 0.99
R1768:Ccp110 UTSW 7 118726024 unclassified probably null
R4737:Ccp110 UTSW 7 118724548 missense possibly damaging 0.96
R4859:Ccp110 UTSW 7 118725430 missense possibly damaging 0.93
R4933:Ccp110 UTSW 7 118725319 missense probably damaging 0.96
R4970:Ccp110 UTSW 7 118722391 missense possibly damaging 0.85
R4999:Ccp110 UTSW 7 118730012 nonsense probably null
R5212:Ccp110 UTSW 7 118729696 missense probably damaging 0.99
R5600:Ccp110 UTSW 7 118729725 critical splice donor site probably null
R6953:Ccp110 UTSW 7 118722421 missense possibly damaging 0.85
R6998:Ccp110 UTSW 7 118732897 missense possibly damaging 0.91
R7076:Ccp110 UTSW 7 118732405 missense probably damaging 1.00
R7092:Ccp110 UTSW 7 118735271 missense probably benign 0.26
R7336:Ccp110 UTSW 7 118722210 missense probably damaging 0.99
R7343:Ccp110 UTSW 7 118724575 missense probably benign 0.03
R7866:Ccp110 UTSW 7 118723018 missense probably benign 0.07
R7949:Ccp110 UTSW 7 118723018 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAAGATGCTTCCCTTCAGGAACGAG -3'
(R):5'- CCAGCAGAAAGTCGTATGGGGTAAC -3'

Sequencing Primer
(F):5'- CCCTTCAGGAACGAGTGTTAG -3'
(R):5'- GGGTAACATACCATTTGCCG -3'
Posted On2014-01-15