Incidental Mutation 'R1217:Edar'
ID99757
Institutional Source Beutler Lab
Gene Symbol Edar
Ensembl Gene ENSMUSG00000003227
Gene Nameectodysplasin-A receptor
Synonymsanhidrotic ectodysplasin receptor 1, ectodermal dysplasia receptor, ectodysplasin A1 isoform receptor (EDA-A1R), downless (dl), ED1R, ED3, ED5, EDA3
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1217 (G1)
Quality Score202
Status Validated
Chromosome10
Chromosomal Location58600789-58675654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58628631 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 62 (Y62C)
Ref Sequence ENSEMBL: ENSMUSP00000003312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003312]
Predicted Effect probably damaging
Transcript: ENSMUST00000003312
AA Change: Y62C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003312
Gene: ENSMUSG00000003227
AA Change: Y62C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:TNFR 31 71 2e-16 BLAST
SCOP:d1jmab1 31 91 2e-3 SMART
Blast:TNFR 74 113 5e-20 BLAST
low complexity region 149 169 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
SCOP:d1ngr__ 348 430 2e-4 SMART
low complexity region 439 448 N/A INTRINSIC
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Edar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Edar APN 10 58628638 missense probably damaging 1.00
IGL01551:Edar APN 10 58606038 splice site probably benign
IGL02207:Edar APN 10 58610521 missense probably damaging 0.99
IGL02391:Edar APN 10 58628581 missense probably damaging 0.96
IGL03152:Edar APN 10 58609995 missense possibly damaging 0.88
achtung2 UTSW 10 58603163 missense probably damaging 1.00
two-tone UTSW 10 58603179 missense probably damaging 1.00
ANU23:Edar UTSW 10 58628638 missense probably damaging 1.00
R0113:Edar UTSW 10 58629449 missense probably damaging 1.00
R0413:Edar UTSW 10 58629440 missense probably benign 0.00
R0927:Edar UTSW 10 58629491 splice site probably null
R1458:Edar UTSW 10 58607366 missense probably benign 0.27
R1651:Edar UTSW 10 58606053 missense possibly damaging 0.49
R3820:Edar UTSW 10 58621363 missense probably damaging 1.00
R3932:Edar UTSW 10 58610342 missense probably damaging 1.00
R4050:Edar UTSW 10 58609947 missense possibly damaging 0.74
R4911:Edar UTSW 10 58621324 missense probably benign 0.03
R4924:Edar UTSW 10 58629375 missense probably damaging 1.00
R4998:Edar UTSW 10 58606093 missense probably damaging 1.00
R5311:Edar UTSW 10 58607435 missense possibly damaging 0.68
R5314:Edar UTSW 10 58607360 missense probably benign 0.00
R5371:Edar UTSW 10 58607452 missense possibly damaging 0.64
R5566:Edar UTSW 10 58628641 missense possibly damaging 0.50
R5847:Edar UTSW 10 58603179 missense probably damaging 1.00
R7330:Edar UTSW 10 58610554 missense probably damaging 0.98
R7529:Edar UTSW 10 58612008 missense probably benign
R7812:Edar UTSW 10 58630104 missense probably benign
R7872:Edar UTSW 10 58610526 missense possibly damaging 0.88
R7955:Edar UTSW 10 58610526 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTTCTGCTCACAGGGTCAGTGTTC -3'
(R):5'- TAGTGAGGCACTCCAAGAAGCCAG -3'

Sequencing Primer
(F):5'- ACAGGGTCAGTGTTCCTCAC -3'
(R):5'- TTAAAGGACCTCATCTGAGGCTG -3'
Posted On2014-01-15