Incidental Mutation 'R1217:Tprg'
ID99776
Institutional Source Beutler Lab
Gene Symbol Tprg
Ensembl Gene ENSMUSG00000048399
Gene Nametransformation related protein 63 regulated
Synonyms
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1217 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location25286817-25422344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25412843 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000052585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056087]
Predicted Effect probably damaging
Transcript: ENSMUST00000056087
AA Change: S190P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052585
Gene: ENSMUSG00000048399
AA Change: S190P

DomainStartEndE-ValueType
Pfam:hSac2 69 176 1.8e-31 PFAM
Meta Mutation Damage Score 0.3858 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Tprg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02999:Tprg APN 16 25317468 missense probably damaging 1.00
IGL03136:Tprg APN 16 25412762 splice site probably benign
R0383:Tprg UTSW 16 25422235 missense probably damaging 1.00
R0831:Tprg UTSW 16 25317469 missense probably damaging 1.00
R1885:Tprg UTSW 16 25412891 missense probably benign 0.11
R1950:Tprg UTSW 16 25317348 missense possibly damaging 0.83
R2869:Tprg UTSW 16 25412840 missense probably damaging 1.00
R2869:Tprg UTSW 16 25412840 missense probably damaging 1.00
R5935:Tprg UTSW 16 25317261 start codon destroyed possibly damaging 0.89
R6122:Tprg UTSW 16 25422401 unclassified probably null
R7423:Tprg UTSW 16 25422253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAAGTCCATCCTTTTACCTCCG -3'
(R):5'- AAGGGGCACATTATGGTCACGTAAC -3'

Sequencing Primer
(F):5'- TGAGGTAAATCACTTAACTCAGGAG -3'
(R):5'- GAGACAGTAAGCTTTTATCTGACC -3'
Posted On2014-01-15