Incidental Mutation 'R1218:Napb'
ID99800
Institutional Source Beutler Lab
Gene Symbol Napb
Ensembl Gene ENSMUSG00000027438
Gene NameN-ethylmaleimide sensitive fusion protein attachment protein beta
SynonymsSNARE, Brp14, b-SNAP, E161, I47
MMRRC Submission 039287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R1218 (G1)
Quality Score213
Status Not validated
Chromosome2
Chromosomal Location148693985-148732467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148700425 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 205 (Y205C)
Ref Sequence ENSEMBL: ENSMUSP00000028926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028926] [ENSMUST00000136513]
Predicted Effect probably damaging
Transcript: ENSMUST00000028926
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028926
Gene: ENSMUSG00000027438
AA Change: Y205C

DomainStartEndE-ValueType
Pfam:SNAP 8 288 7.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136513
SMART Domains Protein: ENSMUSP00000120979
Gene: ENSMUSG00000027438

DomainStartEndE-ValueType
Pfam:SNAP 8 114 3.5e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.9%
  • 10x: 93.3%
  • 20x: 80.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit seizures, ataxia, abnormal synaptic vesicle priming, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C T 15: 82,064,152 T750I probably benign Het
5330417H12Rik T C 7: 107,624,817 probably benign Het
5730559C18Rik A T 1: 136,214,402 V653E probably damaging Het
9230109A22Rik C T 15: 25,138,938 noncoding transcript Het
Ahnak A G 19: 9,015,619 K4756E probably damaging Het
Ano5 A T 7: 51,570,421 probably null Het
Bmp6 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 13: 38,346,250 probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cbfa2t2 A T 2: 154,523,919 M350L probably benign Het
Ceacam20 A T 7: 19,976,097 M349L probably benign Het
Chd1 G T 17: 15,725,312 G33C probably damaging Het
Dhx40 A G 11: 86,799,484 V237A probably benign Het
Dlst G T 12: 85,123,864 D256Y probably damaging Het
Dmxl1 T A 18: 49,893,611 S1929T probably damaging Het
Exosc10 T A 4: 148,570,401 I551N probably damaging Het
Faap100 T C 11: 120,378,340 D91G probably benign Het
Fbn1 T G 2: 125,412,749 Q198P possibly damaging Het
Flrt2 A G 12: 95,778,953 I22V probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Hist1h2bb A G 13: 23,747,159 Y122C probably benign Het
Kcnn1 T C 8: 70,852,688 I293V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Maats1 A G 16: 38,298,133 V768A probably benign Het
Mcpt9 G T 14: 56,028,668 Y34* probably null Het
Mepe A T 5: 104,327,073 M7L probably benign Het
Mprip A G 11: 59,743,814 Y383C probably damaging Het
Myh2 A T 11: 67,192,525 D1438V probably damaging Het
Odf2l A G 3: 145,148,932 D510G probably damaging Het
Olfml2b A G 1: 170,649,782 D162G probably damaging Het
Oscp1 T C 4: 126,058,739 V20A probably benign Het
Pcdhb10 T C 18: 37,413,161 L430P probably damaging Het
Polq A G 16: 37,029,446 D354G possibly damaging Het
Rims1 C A 1: 22,483,175 V481F probably damaging Het
Ryr1 A G 7: 29,086,109 I1719T possibly damaging Het
Skiv2l2 G A 13: 112,917,622 A159V probably damaging Het
Smtn T C 11: 3,530,021 H400R probably benign Het
Snx33 A G 9: 56,925,985 Y267H probably damaging Het
Sstr1 T A 12: 58,213,620 M343K possibly damaging Het
Stx6 T C 1: 155,201,991 V248A probably benign Het
Tbx5 C T 5: 119,838,720 L58F probably damaging Het
Tmem241 A G 18: 12,064,214 Y186H probably damaging Het
Tnfaip8l3 T C 9: 54,027,476 K72E probably damaging Het
Trrap T A 5: 144,816,409 I1848N probably damaging Het
Xrcc6 G A 15: 82,022,941 V155I probably benign Het
Zfp458 T C 13: 67,256,209 E722G probably damaging Het
Zfyve1 G T 12: 83,548,051 H722Q possibly damaging Het
Other mutations in Napb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Napb APN 2 148707169 missense probably damaging 0.97
IGL02987:Napb APN 2 148697511 splice site probably null
R0068:Napb UTSW 2 148698923 splice site probably benign
R0068:Napb UTSW 2 148698923 splice site probably benign
R1851:Napb UTSW 2 148706989 missense probably benign 0.01
R3508:Napb UTSW 2 148698960 missense probably benign
R3689:Napb UTSW 2 148703057 splice site probably null
R3691:Napb UTSW 2 148703057 splice site probably null
R4377:Napb UTSW 2 148732264 critical splice donor site probably null
R4541:Napb UTSW 2 148709309 splice site probably benign
R4728:Napb UTSW 2 148709325 missense probably damaging 1.00
R5028:Napb UTSW 2 148703137 missense possibly damaging 0.90
R5982:Napb UTSW 2 148700491 splice site probably null
R6228:Napb UTSW 2 148698178 splice site probably null
R6944:Napb UTSW 2 148706969 missense probably benign
R6998:Napb UTSW 2 148700425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGAAAGAGTCAAACTCGCAC -3'
(R):5'- GCAAGCAAGCAAGCAAACTTCTAGTTG -3'

Sequencing Primer
(F):5'- ctgcttatctctgctttgctc -3'
(R):5'- agcaagCAAACTTCTAGTTGTATTTC -3'
Posted On2014-01-15